Mutagenetix > Incidental Mutation

Incidental Mutation 'R7747:Stx2'

596896

Institutional Source

Beutler Lab

Gene Symbol

Stx2

Ensembl Gene

ENSMUSG00000029428

Gene Name

syntaxin 2

Synonyms

repro34, G1-536-1, Syn-2, Epim

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_007941.2; MGI:108059

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128984557-129008574 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128986417 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 268 (V268D)

Ref Sequence

ENSEMBL: ENSMUSP00000098247 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031378] [ENSMUST00000100680]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000031378

SMART Domains

Protein: ENSMUSP00000031378
Gene: ENSMUSG00000029428

Domain	Start	End	E-Value	Type
SynN	25	146	1.33e-40	SMART
low complexity region	159	170	N/A	INTRINSIC
low complexity region	175	185	N/A	INTRINSIC
t_SNARE	187	254	1.74e-19	SMART
transmembrane domain	266	288	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100680
AA Change: V268D

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000098247
Gene: ENSMUSG00000029428
AA Change: V268D

Domain	Start	End	E-Value	Type
SynN	25	146	1.33e-40	SMART
low complexity region	159	170	N/A	INTRINSIC
low complexity region	175	185	N/A	INTRINSIC
t_SNARE	187	254	1.74e-19	SMART
transmembrane domain	265	287	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (89/89)

MGI Phenotype

Strain: 3526405
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the syntaxin/epimorphin family of proteins. The syntaxins are a large protein family implicated in the targeting and fusion of intracellular transport vesicles. The product of this gene regulates epithelial-mesenchymal interactions and epithelial cell morphogenesis and activation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display male infertility associated with abnormal testicular development and impaired spermatogenesis, increased intestinal growth due to enhanced crypt cell proliferation and crypt fission, and decreased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(4) Gene trapped(5) Chemically induced(1)

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109A12Rik	G	A	5: 93,206,557		probably null	Het
2410004P03Rik	C	T	12: 17,007,148	S116N	probably damaging	Het
3425401B19Rik	T	C	14: 32,663,069	D313G	possibly damaging	Het
AA986860	A	G	1: 130,743,547	E502G	possibly damaging	Het
Adamts20	T	A	15: 94,291,587	K1462*	probably null	Het
Adgrg6	A	C	10: 14,450,577		probably null	Het
Ankrd13d	G	A	19: 4,280,985	H165Y	probably damaging	Het
Arap3	T	C	18: 37,988,888		probably null	Het
Arhgap33	A	G	7: 30,524,135	V823A	probably damaging	Het
Aup1	C	A	6: 83,054,795	P34T	unknown	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicc1	T	C	10: 70,946,993	T515A	probably benign	Het
Ccdc73	A	C	2: 104,929,556	K106Q	probably damaging	Het
Celsr3	G	A	9: 108,829,978	R1220Q	possibly damaging	Het
Cep290	C	T	10: 100,558,176	Q2082*	probably null	Het
Cercam	A	G	2: 29,871,286	D104G	probably benign	Het
Champ1	A	G	8: 13,879,990	H716R	probably damaging	Het
Cntrl	A	T	2: 35,116,798	I159F	probably damaging	Het
Col11a1	T	C	3: 114,102,572	I507T	unknown	Het
Cped1	T	C	6: 22,143,974	I573T	probably damaging	Het
Crot	C	T	5: 8,968,869		probably null	Het
D1Pas1	T	A	1: 186,968,677	S268T	probably benign	Het
Erich6	A	G	3: 58,618,928	V551A	probably damaging	Het
Fbxo32	T	C	15: 58,191,361	N192S	probably damaging	Het
Fgd6	T	C	10: 94,044,916	V544A	probably damaging	Het
Fnbp1	C	T	2: 31,036,147	G552E	probably damaging	Het
Gjb5	A	T	4: 127,356,162	V63D	probably damaging	Het
Gm10053	T	C	19: 24,876,039	I96T	probably benign	Het
Gm11639	T	G	11: 104,842,603	I2011S	probably damaging	Het
Gm38119	T	C	3: 92,738,021	S89G	unknown	Het
Gm884	A	T	11: 103,614,255	S2296T	probably damaging	Het
Gpn2	A	G	4: 133,586,045	I183V	probably benign	Het
Greb1	C	T	12: 16,674,795	V1793M	probably benign	Het
H2-Q7	A	G	17: 35,440,061	I163V	probably benign	Het
Hrh2	T	C	13: 54,214,530	V175A	possibly damaging	Het
Hsd3b3	C	T	3: 98,743,898	V79I	possibly damaging	Het
Itgb7	T	C	15: 102,216,604	I727M	possibly damaging	Het
Kcnj16	T	A	11: 111,024,743	F77Y	probably damaging	Het
Lilra6	T	A	7: 3,912,996	Q288L	probably benign	Het
Malrd1	G	A	2: 16,074,835	V1788M	unknown	Het
Mau2	T	C	8: 70,026,723	I349V	possibly damaging	Het
Mbnl3	C	T	X: 51,130,334	R181H	probably damaging	Het
Mfsd6	T	C	1: 52,676,547	T524A	probably benign	Het
Mical2	G	T	7: 112,333,839	R740L	probably benign	Het
Mknk1	G	A	4: 115,878,072	C379Y	possibly damaging	Het
Mta3	A	T	17: 83,791,736	K410*	probably null	Het
Myb	A	C	10: 21,156,425	I19S	possibly damaging	Het
Ncor2	A	G	5: 125,027,038	F996S		Het
Nlrp1a	T	C	11: 71,123,408	M339V	possibly damaging	Het
Olfr136	C	T	17: 38,335,394	P79L	probably benign	Het
Olfr689	A	G	7: 105,314,447	K148E	probably damaging	Het
Pcdhga5	C	T	18: 37,696,782	T761I	possibly damaging	Het
Pcmtd2	T	C	2: 181,851,659	L219P	possibly damaging	Het
Pfdn1	C	T	18: 36,432,305		probably null	Het
Pkn3	G	A	2: 30,090,584	C829Y	probably benign	Het
Pld1	T	C	3: 28,087,189	S634P	possibly damaging	Het
Pofut2	T	G	10: 77,262,470	V139G	possibly damaging	Het
Prdm12	C	A	2: 31,653,871		probably null	Het
Prkar2b	C	A	12: 32,060,938	A49S	probably benign	Het
Prmt1	A	T	7: 44,984,136		probably null	Het
Rab39	A	T	9: 53,686,400	D188E	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Scgb1b19	A	G	7: 33,287,498	I25V	probably benign	Het
Scn9a	A	T	2: 66,484,298	I1692N	probably damaging	Het
Sdk1	G	T	5: 142,084,491	G1137V	probably damaging	Het
Sec16b	A	G	1: 157,565,472	T950A	possibly damaging	Het
Senp2	G	T	16: 22,038,622	R398L	probably damaging	Het
Sfswap	G	T	5: 129,550,593		probably null	Het
Sh3rf1	A	G	8: 61,353,753	T362A	probably damaging	Het
Slc17a1	A	T	13: 23,888,052	I418F	probably benign	Het
Slc1a4	A	T	11: 20,308,587	M284K	probably damaging	Het
Slc5a2	A	T	7: 128,266,395		probably null	Het
Slco5a1	A	G	1: 12,990,122	V125A	probably benign	Het
Smu1	A	G	4: 40,748,600	V230A	probably benign	Het
Sp4	A	G	12: 118,254,404		probably null	Het
Stbd1	A	G	5: 92,605,557	K302R	probably damaging	Het
Tbc1d9b	G	A	11: 50,161,620	A885T	probably benign	Het
Tbce	T	A	13: 14,006,478	D267V	possibly damaging	Het
Tert	T	C	13: 73,627,606	Y159H	probably damaging	Het
Thbs2	T	A	17: 14,670,039	I1102F	possibly damaging	Het
Tmprss7	G	C	16: 45,683,510	A183G	probably benign	Het
Top3b	C	A	16: 16,887,721	P450Q	probably benign	Het
Trpm6	A	T	19: 18,750,045		probably null	Het
Ube4a	T	C	9: 44,925,973	D988G	probably damaging	Het
Vmn1r158	A	T	7: 22,790,300	S161R	probably benign	Het
Vps41	T	C	13: 18,841,252		probably null	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp617	T	A	8: 71,928,189		probably null	Het
Zfp808	C	T	13: 62,171,505	H183Y	probably benign	Het
Zfy1	A	T	Y: 725,496	C756*	probably null	Het
Zswim2	A	T	2: 83,915,607	Y496N	probably damaging	Het

Other mutations in Stx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01729:Stx2	APN	5	128990978	missense	probably benign	0.01
IGL01951:Stx2	APN	5	128992265	missense	probably damaging	1.00
IGL02348:Stx2	APN	5	128988830	missense	probably damaging	1.00
IGL02902:Stx2	APN	5	128992221	missense	probably damaging	1.00
R0050:Stx2	UTSW	5	128999508	critical splice donor site	probably null
R0050:Stx2	UTSW	5	128999508	critical splice donor site	probably null
R0277:Stx2	UTSW	5	128988903	missense	probably benign	0.00
R0323:Stx2	UTSW	5	128988903	missense	probably benign	0.00
R0419:Stx2	UTSW	5	128993577	splice site	probably benign
R0843:Stx2	UTSW	5	128999548	missense	probably damaging	1.00
R1346:Stx2	UTSW	5	128988788	unclassified	probably benign
R1631:Stx2	UTSW	5	128992225	missense	probably damaging	1.00
R1920:Stx2	UTSW	5	128988839	missense	probably damaging	1.00
R5350:Stx2	UTSW	5	128991091	missense	probably damaging	1.00
R6877:Stx2	UTSW	5	128987820	missense	probably benign	0.00
R7379:Stx2	UTSW	5	128987799	missense	possibly damaging	0.68
R7391:Stx2	UTSW	5	128988803	missense	probably damaging	1.00
R7803:Stx2	UTSW	5	128993563	nonsense	probably null
R8354:Stx2	UTSW	5	128994868	missense	probably benign	0.00
R8725:Stx2	UTSW	5	128993500	missense	probably damaging	0.96
R9348:Stx2	UTSW	5	128999537	missense	probably benign	0.00
R9768:Stx2	UTSW	5	128986358	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTCGCGGTGTTTCATGGTAC -3'
(R):5'- TCCCTCATGAAACTAGAGGAGACAG -3'

Sequencing Primer
(F):5'- TAAAAACCTCAGTGCTCGGCG -3'
(R):5'- CTAGAGGAGACAGCTGGGCC -3'

Posted On

2019-11-26