Mutagenetix > Incidental Mutation

Incidental Mutation 'R7747:Sh3rf1'

596908

Institutional Source

Beutler Lab

Gene Symbol

Sh3rf1

Ensembl Gene

ENSMUSG00000031642

Gene Name

SH3 domain containing ring finger 1

Synonyms

Sh3md2, Posh, 2200003J05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.287) question?

Stock #

R7747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61223872-61396071 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 61353753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 362 (T362A)

Ref Sequence

ENSEMBL: ENSMUSP00000034060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034060] [ENSMUST00000209611]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034060
AA Change: T362A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000034060
Gene: ENSMUSG00000031642
AA Change: T362A

Domain	Start	End	E-Value	Type
RING	12	52	5.3e-9	SMART
low complexity region	83	90	N/A	INTRINSIC
SH3	137	192	1.67e-18	SMART
SH3	199	258	4.84e-15	SMART
low complexity region	366	376	N/A	INTRINSIC
low complexity region	397	405	N/A	INTRINSIC
low complexity region	417	430	N/A	INTRINSIC
SH3	454	511	7.92e-20	SMART
low complexity region	558	569	N/A	INTRINSIC
low complexity region	638	651	N/A	INTRINSIC
low complexity region	700	734	N/A	INTRINSIC
SH3	835	891	1.47e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000209611
AA Change: T362A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (89/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an N-terminus RING-finger, four SH3 domains, and a region implicated in binding of the Rho GTPase Rac. Via the RING-finger, the encoded protein has been shown to function as an ubiquitin-protein ligase involved in protein sorting at the trans-Golgi network. The encoded protein may also act as a scaffold for the c-Jun N-terminal kinase signaling pathway, facilitating the formation of a functional signaling module. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109A12Rik	G	A	5: 93,206,557		probably null	Het
2410004P03Rik	C	T	12: 17,007,148	S116N	probably damaging	Het
3425401B19Rik	T	C	14: 32,663,069	D313G	possibly damaging	Het
AA986860	A	G	1: 130,743,547	E502G	possibly damaging	Het
Adamts20	T	A	15: 94,291,587	K1462*	probably null	Het
Adgrg6	A	C	10: 14,450,577		probably null	Het
Ankrd13d	G	A	19: 4,280,985	H165Y	probably damaging	Het
Arap3	T	C	18: 37,988,888		probably null	Het
Arhgap33	A	G	7: 30,524,135	V823A	probably damaging	Het
Aup1	C	A	6: 83,054,795	P34T	unknown	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicc1	T	C	10: 70,946,993	T515A	probably benign	Het
Ccdc73	A	C	2: 104,929,556	K106Q	probably damaging	Het
Celsr3	G	A	9: 108,829,978	R1220Q	possibly damaging	Het
Cep290	C	T	10: 100,558,176	Q2082*	probably null	Het
Cercam	A	G	2: 29,871,286	D104G	probably benign	Het
Champ1	A	G	8: 13,879,990	H716R	probably damaging	Het
Cntrl	A	T	2: 35,116,798	I159F	probably damaging	Het
Col11a1	T	C	3: 114,102,572	I507T	unknown	Het
Cped1	T	C	6: 22,143,974	I573T	probably damaging	Het
Crot	C	T	5: 8,968,869		probably null	Het
D1Pas1	T	A	1: 186,968,677	S268T	probably benign	Het
Erich6	A	G	3: 58,618,928	V551A	probably damaging	Het
Fbxo32	T	C	15: 58,191,361	N192S	probably damaging	Het
Fgd6	T	C	10: 94,044,916	V544A	probably damaging	Het
Fnbp1	C	T	2: 31,036,147	G552E	probably damaging	Het
Gjb5	A	T	4: 127,356,162	V63D	probably damaging	Het
Gm10053	T	C	19: 24,876,039	I96T	probably benign	Het
Gm11639	T	G	11: 104,842,603	I2011S	probably damaging	Het
Gm38119	T	C	3: 92,738,021	S89G	unknown	Het
Gm884	A	T	11: 103,614,255	S2296T	probably damaging	Het
Gpn2	A	G	4: 133,586,045	I183V	probably benign	Het
Greb1	C	T	12: 16,674,795	V1793M	probably benign	Het
H2-Q7	A	G	17: 35,440,061	I163V	probably benign	Het
Hrh2	T	C	13: 54,214,530	V175A	possibly damaging	Het
Hsd3b3	C	T	3: 98,743,898	V79I	possibly damaging	Het
Itgb7	T	C	15: 102,216,604	I727M	possibly damaging	Het
Kcnj16	T	A	11: 111,024,743	F77Y	probably damaging	Het
Lilra6	T	A	7: 3,912,996	Q288L	probably benign	Het
Malrd1	G	A	2: 16,074,835	V1788M	unknown	Het
Mau2	T	C	8: 70,026,723	I349V	possibly damaging	Het
Mbnl3	C	T	X: 51,130,334	R181H	probably damaging	Het
Mfsd6	T	C	1: 52,676,547	T524A	probably benign	Het
Mical2	G	T	7: 112,333,839	R740L	probably benign	Het
Mknk1	G	A	4: 115,878,072	C379Y	possibly damaging	Het
Mta3	A	T	17: 83,791,736	K410*	probably null	Het
Myb	A	C	10: 21,156,425	I19S	possibly damaging	Het
Ncor2	A	G	5: 125,027,038	F996S		Het
Nlrp1a	T	C	11: 71,123,408	M339V	possibly damaging	Het
Olfr136	C	T	17: 38,335,394	P79L	probably benign	Het
Olfr689	A	G	7: 105,314,447	K148E	probably damaging	Het
Pcdhga5	C	T	18: 37,696,782	T761I	possibly damaging	Het
Pcmtd2	T	C	2: 181,851,659	L219P	possibly damaging	Het
Pfdn1	C	T	18: 36,432,305		probably null	Het
Pkn3	G	A	2: 30,090,584	C829Y	probably benign	Het
Pld1	T	C	3: 28,087,189	S634P	possibly damaging	Het
Pofut2	T	G	10: 77,262,470	V139G	possibly damaging	Het
Prdm12	C	A	2: 31,653,871		probably null	Het
Prkar2b	C	A	12: 32,060,938	A49S	probably benign	Het
Prmt1	A	T	7: 44,984,136		probably null	Het
Rab39	A	T	9: 53,686,400	D188E	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Scgb1b19	A	G	7: 33,287,498	I25V	probably benign	Het
Scn9a	A	T	2: 66,484,298	I1692N	probably damaging	Het
Sdk1	G	T	5: 142,084,491	G1137V	probably damaging	Het
Sec16b	A	G	1: 157,565,472	T950A	possibly damaging	Het
Senp2	G	T	16: 22,038,622	R398L	probably damaging	Het
Sfswap	G	T	5: 129,550,593		probably null	Het
Slc17a1	A	T	13: 23,888,052	I418F	probably benign	Het
Slc1a4	A	T	11: 20,308,587	M284K	probably damaging	Het
Slc5a2	A	T	7: 128,266,395		probably null	Het
Slco5a1	A	G	1: 12,990,122	V125A	probably benign	Het
Smu1	A	G	4: 40,748,600	V230A	probably benign	Het
Sp4	A	G	12: 118,254,404		probably null	Het
Stbd1	A	G	5: 92,605,557	K302R	probably damaging	Het
Stx2	A	T	5: 128,986,417	V268D	probably benign	Het
Tbc1d9b	G	A	11: 50,161,620	A885T	probably benign	Het
Tbce	T	A	13: 14,006,478	D267V	possibly damaging	Het
Tert	T	C	13: 73,627,606	Y159H	probably damaging	Het
Thbs2	T	A	17: 14,670,039	I1102F	possibly damaging	Het
Tmprss7	G	C	16: 45,683,510	A183G	probably benign	Het
Top3b	C	A	16: 16,887,721	P450Q	probably benign	Het
Trpm6	A	T	19: 18,750,045		probably null	Het
Ube4a	T	C	9: 44,925,973	D988G	probably damaging	Het
Vmn1r158	A	T	7: 22,790,300	S161R	probably benign	Het
Vps41	T	C	13: 18,841,252		probably null	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp617	T	A	8: 71,928,189		probably null	Het
Zfp808	C	T	13: 62,171,505	H183Y	probably benign	Het
Zfy1	A	T	Y: 725,496	C756*	probably null	Het
Zswim2	A	T	2: 83,915,607	Y496N	probably damaging	Het

Other mutations in Sh3rf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Sh3rf1	APN	8	61329336	missense	probably damaging	1.00
IGL01071:Sh3rf1	APN	8	61225959	missense	probably damaging	1.00
IGL01485:Sh3rf1	APN	8	61329331	missense	possibly damaging	0.79
IGL01587:Sh3rf1	APN	8	61226058	missense	probably damaging	0.99
IGL02412:Sh3rf1	APN	8	61372689	missense	probably benign	0.35
IGL02649:Sh3rf1	APN	8	61363191	missense	probably damaging	1.00
limpid	UTSW	8	61329258	missense	probably damaging	1.00
Mac	UTSW	8	61361773	critical splice donor site	probably null
Moki	UTSW	8	61384826	missense	probably benign	0.17
IGL02835:Sh3rf1	UTSW	8	61226047	missense	probably damaging	1.00
R0009:Sh3rf1	UTSW	8	61226293	missense	probably damaging	0.97
R0016:Sh3rf1	UTSW	8	61374138	missense	probably benign	0.18
R0040:Sh3rf1	UTSW	8	61329252	missense	possibly damaging	0.96
R0040:Sh3rf1	UTSW	8	61329252	missense	possibly damaging	0.96
R0278:Sh3rf1	UTSW	8	61374018	missense	probably damaging	1.00
R0395:Sh3rf1	UTSW	8	61393662	splice site	probably benign
R0733:Sh3rf1	UTSW	8	61372560	missense	probably benign	0.00
R0790:Sh3rf1	UTSW	8	61329258	missense	probably damaging	1.00
R1028:Sh3rf1	UTSW	8	61393787	missense	possibly damaging	0.94
R1569:Sh3rf1	UTSW	8	61384862	missense	probably damaging	1.00
R1654:Sh3rf1	UTSW	8	61361745	missense	possibly damaging	0.92
R1799:Sh3rf1	UTSW	8	61372627	missense	probably damaging	0.99
R1960:Sh3rf1	UTSW	8	61384863	missense	probably damaging	1.00
R2181:Sh3rf1	UTSW	8	61363238	missense	probably damaging	0.98
R2184:Sh3rf1	UTSW	8	61372654	missense	probably damaging	0.99
R2330:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R2331:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R2332:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R2967:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R2994:Sh3rf1	UTSW	8	61372575	missense	probably benign	0.10
R3159:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R3195:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R3196:Sh3rf1	UTSW	8	61226287	missense	probably benign	0.01
R3724:Sh3rf1	UTSW	8	61372722	missense	probably benign
R4692:Sh3rf1	UTSW	8	61353854	splice site	probably null
R4712:Sh3rf1	UTSW	8	61361759	missense	probably benign	0.00
R5214:Sh3rf1	UTSW	8	61372731	missense	probably damaging	0.98
R5409:Sh3rf1	UTSW	8	61374245	missense	probably benign	0.01
R5590:Sh3rf1	UTSW	8	61361732	missense	probably benign	0.11
R5651:Sh3rf1	UTSW	8	61363167	missense	probably damaging	1.00
R6976:Sh3rf1	UTSW	8	61361732	nonsense	probably null
R7126:Sh3rf1	UTSW	8	61349424	missense	probably benign	0.01
R7154:Sh3rf1	UTSW	8	61372714	missense	possibly damaging	0.89
R7625:Sh3rf1	UTSW	8	61372722	missense	probably benign
R8217:Sh3rf1	UTSW	8	61329930	missense	possibly damaging	0.95
R8705:Sh3rf1	UTSW	8	61349557	missense	probably damaging	1.00
R8711:Sh3rf1	UTSW	8	61329996	missense	probably damaging	1.00
R8735:Sh3rf1	UTSW	8	61372653	missense	probably benign	0.30
R8969:Sh3rf1	UTSW	8	61384826	missense	probably benign	0.17
R9015:Sh3rf1	UTSW	8	61374168	missense	probably benign	0.00
R9085:Sh3rf1	UTSW	8	61349459	missense	probably benign	0.00
R9089:Sh3rf1	UTSW	8	61372579	missense	probably benign	0.01
R9188:Sh3rf1	UTSW	8	61361773	critical splice donor site	probably null
R9259:Sh3rf1	UTSW	8	61353804	missense	probably benign	0.05
R9568:Sh3rf1	UTSW	8	61372551	missense	probably benign	0.03
R9688:Sh3rf1	UTSW	8	61226314	missense	probably benign	0.13
X0066:Sh3rf1	UTSW	8	61226197	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TATACAGATCCTCTTGTCTGTGTG -3'
(R):5'- TTGGCTGGACTATGGCAGAC -3'

Sequencing Primer
(F):5'- CCAGGTCAACTTGTCTGGCATAAG -3'
(R):5'- TGGCAGACCATCAAGACTAAAG -3'

Posted On

2019-11-26