Incidental Mutation 'R0632:Nol6'
ID 59691
Institutional Source Beutler Lab
Gene Symbol Nol6
Ensembl Gene ENSMUSG00000028430
Gene Name nucleolar protein family 6 (RNA-associated)
Synonyms Nrap
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R0632 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 41114427-41124450 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41121115 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 353 (F353I)
Ref Sequence ENSEMBL: ENSMUSP00000030138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030138]
AlphaFold Q8R5K4
Predicted Effect probably damaging
Transcript: ENSMUST00000030138
AA Change: F353I

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030138
Gene: ENSMUSG00000028430
AA Change: F353I

DomainStartEndE-ValueType
Pfam:Nrap 174 1145 5e-287 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155315
Meta Mutation Damage Score 0.6913 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleolus is a dense subnuclear membraneless organelle that assembles around clusters of rRNA genes and functions in ribosome biogenesis. This gene encodes a nucleolar RNA-associated protein that is highly conserved between species. RNase treatment of permeabilized cells indicates that the nucleolar localization is RNA dependent. Further studies suggest that the protein is associated with ribosome biogenesis through an interaction with pre-rRNA primary transcripts. Alternative splicing has been observed at this locus and two splice variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Nol6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nol6 APN 4 41,123,374 (GRCm39) missense possibly damaging 0.89
IGL00787:Nol6 APN 4 41,122,198 (GRCm39) missense probably benign 0.10
IGL01062:Nol6 APN 4 41,118,205 (GRCm39) missense probably benign 0.13
IGL01113:Nol6 APN 4 41,115,749 (GRCm39) missense probably damaging 1.00
IGL01874:Nol6 APN 4 41,115,412 (GRCm39) missense probably damaging 1.00
IGL01995:Nol6 APN 4 41,118,567 (GRCm39) missense probably damaging 1.00
IGL02060:Nol6 APN 4 41,117,700 (GRCm39) missense probably damaging 1.00
IGL03082:Nol6 APN 4 41,115,878 (GRCm39) splice site probably benign
IGL03221:Nol6 APN 4 41,124,166 (GRCm39) missense probably benign 0.00
IGL03332:Nol6 APN 4 41,120,735 (GRCm39) missense probably damaging 1.00
leaky UTSW 4 41,118,154 (GRCm39) missense probably benign 0.02
R0066:Nol6 UTSW 4 41,119,572 (GRCm39) splice site probably benign
R0066:Nol6 UTSW 4 41,119,572 (GRCm39) splice site probably benign
R0308:Nol6 UTSW 4 41,123,584 (GRCm39) missense probably benign 0.01
R1222:Nol6 UTSW 4 41,120,760 (GRCm39) missense probably benign 0.01
R1471:Nol6 UTSW 4 41,120,281 (GRCm39) missense probably benign 0.00
R1481:Nol6 UTSW 4 41,123,596 (GRCm39) missense probably benign 0.00
R1971:Nol6 UTSW 4 41,119,542 (GRCm39) missense probably damaging 1.00
R2191:Nol6 UTSW 4 41,118,720 (GRCm39) missense probably benign 0.00
R2495:Nol6 UTSW 4 41,118,427 (GRCm39) missense probably damaging 1.00
R3852:Nol6 UTSW 4 41,117,452 (GRCm39) missense probably damaging 0.99
R3923:Nol6 UTSW 4 41,121,531 (GRCm39) missense probably benign 0.17
R4458:Nol6 UTSW 4 41,115,888 (GRCm39) missense probably damaging 1.00
R4510:Nol6 UTSW 4 41,123,526 (GRCm39) missense probably damaging 1.00
R4511:Nol6 UTSW 4 41,123,526 (GRCm39) missense probably damaging 1.00
R4575:Nol6 UTSW 4 41,120,299 (GRCm39) missense probably benign 0.00
R4637:Nol6 UTSW 4 41,121,788 (GRCm39) missense probably damaging 0.99
R4700:Nol6 UTSW 4 41,118,944 (GRCm39) missense possibly damaging 0.58
R4820:Nol6 UTSW 4 41,121,508 (GRCm39) missense probably damaging 1.00
R4975:Nol6 UTSW 4 41,120,167 (GRCm39) missense probably benign 0.00
R5395:Nol6 UTSW 4 41,118,392 (GRCm39) intron probably benign
R5826:Nol6 UTSW 4 41,122,158 (GRCm39) missense probably benign 0.04
R6531:Nol6 UTSW 4 41,118,154 (GRCm39) missense probably benign 0.02
R6943:Nol6 UTSW 4 41,118,962 (GRCm39) missense probably damaging 1.00
R7001:Nol6 UTSW 4 41,121,279 (GRCm39) missense probably benign 0.00
R7035:Nol6 UTSW 4 41,118,479 (GRCm39) missense probably benign 0.01
R7282:Nol6 UTSW 4 41,119,468 (GRCm39) missense probably benign 0.18
R7327:Nol6 UTSW 4 41,116,686 (GRCm39) missense probably benign 0.34
R7402:Nol6 UTSW 4 41,118,699 (GRCm39) missense probably damaging 1.00
R7483:Nol6 UTSW 4 41,117,424 (GRCm39) missense possibly damaging 0.92
R7505:Nol6 UTSW 4 41,120,352 (GRCm39) missense probably damaging 1.00
R7669:Nol6 UTSW 4 41,118,717 (GRCm39) missense probably damaging 0.97
R8255:Nol6 UTSW 4 41,120,168 (GRCm39) missense probably benign 0.01
R8401:Nol6 UTSW 4 41,119,548 (GRCm39) missense possibly damaging 0.87
R8426:Nol6 UTSW 4 41,119,870 (GRCm39) missense probably benign 0.36
R8826:Nol6 UTSW 4 41,121,823 (GRCm39) missense probably benign 0.26
R9228:Nol6 UTSW 4 41,116,422 (GRCm39) missense probably benign 0.42
R9259:Nol6 UTSW 4 41,118,229 (GRCm39) missense possibly damaging 0.84
R9571:Nol6 UTSW 4 41,120,156 (GRCm39) missense probably benign 0.00
R9604:Nol6 UTSW 4 41,120,298 (GRCm39) missense probably benign 0.05
R9748:Nol6 UTSW 4 41,123,538 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCTGGTGGAATAAGAGAACCCC -3'
(R):5'- CGCTTGCTGCCAACTAAGAACAATG -3'

Sequencing Primer
(F):5'- CCGGGGACAAGCGGAAC -3'
(R):5'- CTAAGAACAATGTGCGCTCTG -3'
Posted On 2013-07-11