Mutagenetix > Incidental Mutation

Incidental Mutation 'R7747:Bicc1'

596915

Institutional Source

Beutler Lab

Gene Symbol

Bicc1

Ensembl Gene

ENSMUSG00000014329

Gene Name

BicC family RNA binding protein 1

Synonyms

Bic-C, jcpk

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70922832-71159700 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70946993 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 515 (T515A)

Ref Sequence

ENSEMBL: ENSMUSP00000123201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]

AlphaFold

Q99MQ1

Predicted Effect

probably benign
Transcript: ENSMUST00000014473
AA Change: T515A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: T515A

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	2.04e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131445
AA Change: T433A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: T433A

Domain	Start	End	E-Value	Type
SCOP:d1dtja_	1	46	1e-2	SMART
Blast:KH	1	47	1e-22	BLAST
KH	51	124	6.24e-18	SMART
KH	203	273	1.25e-8	SMART
low complexity region	302	320	N/A	INTRINSIC
low complexity region	365	385	N/A	INTRINSIC
low complexity region	398	417	N/A	INTRINSIC
low complexity region	618	636	N/A	INTRINSIC
low complexity region	654	665	N/A	INTRINSIC
low complexity region	712	733	N/A	INTRINSIC
SAM	790	856	2.04e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143791
AA Change: T515A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: T515A

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	4.26e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (89/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109A12Rik	G	A	5: 93,206,557		probably null	Het
2410004P03Rik	C	T	12: 17,007,148	S116N	probably damaging	Het
3425401B19Rik	T	C	14: 32,663,069	D313G	possibly damaging	Het
AA986860	A	G	1: 130,743,547	E502G	possibly damaging	Het
Adamts20	T	A	15: 94,291,587	K1462*	probably null	Het
Adgrg6	A	C	10: 14,450,577		probably null	Het
Ankrd13d	G	A	19: 4,280,985	H165Y	probably damaging	Het
Arap3	T	C	18: 37,988,888		probably null	Het
Arhgap33	A	G	7: 30,524,135	V823A	probably damaging	Het
Aup1	C	A	6: 83,054,795	P34T	unknown	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Ccdc73	A	C	2: 104,929,556	K106Q	probably damaging	Het
Celsr3	G	A	9: 108,829,978	R1220Q	possibly damaging	Het
Cep290	C	T	10: 100,558,176	Q2082*	probably null	Het
Cercam	A	G	2: 29,871,286	D104G	probably benign	Het
Champ1	A	G	8: 13,879,990	H716R	probably damaging	Het
Cntrl	A	T	2: 35,116,798	I159F	probably damaging	Het
Col11a1	T	C	3: 114,102,572	I507T	unknown	Het
Cped1	T	C	6: 22,143,974	I573T	probably damaging	Het
Crot	C	T	5: 8,968,869		probably null	Het
D1Pas1	T	A	1: 186,968,677	S268T	probably benign	Het
Erich6	A	G	3: 58,618,928	V551A	probably damaging	Het
Fbxo32	T	C	15: 58,191,361	N192S	probably damaging	Het
Fgd6	T	C	10: 94,044,916	V544A	probably damaging	Het
Fnbp1	C	T	2: 31,036,147	G552E	probably damaging	Het
Gjb5	A	T	4: 127,356,162	V63D	probably damaging	Het
Gm10053	T	C	19: 24,876,039	I96T	probably benign	Het
Gm11639	T	G	11: 104,842,603	I2011S	probably damaging	Het
Gm38119	T	C	3: 92,738,021	S89G	unknown	Het
Gm884	A	T	11: 103,614,255	S2296T	probably damaging	Het
Gpn2	A	G	4: 133,586,045	I183V	probably benign	Het
Greb1	C	T	12: 16,674,795	V1793M	probably benign	Het
H2-Q7	A	G	17: 35,440,061	I163V	probably benign	Het
Hrh2	T	C	13: 54,214,530	V175A	possibly damaging	Het
Hsd3b3	C	T	3: 98,743,898	V79I	possibly damaging	Het
Itgb7	T	C	15: 102,216,604	I727M	possibly damaging	Het
Kcnj16	T	A	11: 111,024,743	F77Y	probably damaging	Het
Lilra6	T	A	7: 3,912,996	Q288L	probably benign	Het
Malrd1	G	A	2: 16,074,835	V1788M	unknown	Het
Mau2	T	C	8: 70,026,723	I349V	possibly damaging	Het
Mbnl3	C	T	X: 51,130,334	R181H	probably damaging	Het
Mfsd6	T	C	1: 52,676,547	T524A	probably benign	Het
Mical2	G	T	7: 112,333,839	R740L	probably benign	Het
Mknk1	G	A	4: 115,878,072	C379Y	possibly damaging	Het
Mta3	A	T	17: 83,791,736	K410*	probably null	Het
Myb	A	C	10: 21,156,425	I19S	possibly damaging	Het
Ncor2	A	G	5: 125,027,038	F996S		Het
Nlrp1a	T	C	11: 71,123,408	M339V	possibly damaging	Het
Olfr136	C	T	17: 38,335,394	P79L	probably benign	Het
Olfr689	A	G	7: 105,314,447	K148E	probably damaging	Het
Pcdhga5	C	T	18: 37,696,782	T761I	possibly damaging	Het
Pcmtd2	T	C	2: 181,851,659	L219P	possibly damaging	Het
Pfdn1	C	T	18: 36,432,305		probably null	Het
Pkn3	G	A	2: 30,090,584	C829Y	probably benign	Het
Pld1	T	C	3: 28,087,189	S634P	possibly damaging	Het
Pofut2	T	G	10: 77,262,470	V139G	possibly damaging	Het
Prdm12	C	A	2: 31,653,871		probably null	Het
Prkar2b	C	A	12: 32,060,938	A49S	probably benign	Het
Prmt1	A	T	7: 44,984,136		probably null	Het
Rab39	A	T	9: 53,686,400	D188E	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Scgb1b19	A	G	7: 33,287,498	I25V	probably benign	Het
Scn9a	A	T	2: 66,484,298	I1692N	probably damaging	Het
Sdk1	G	T	5: 142,084,491	G1137V	probably damaging	Het
Sec16b	A	G	1: 157,565,472	T950A	possibly damaging	Het
Senp2	G	T	16: 22,038,622	R398L	probably damaging	Het
Sfswap	G	T	5: 129,550,593		probably null	Het
Sh3rf1	A	G	8: 61,353,753	T362A	probably damaging	Het
Slc17a1	A	T	13: 23,888,052	I418F	probably benign	Het
Slc1a4	A	T	11: 20,308,587	M284K	probably damaging	Het
Slc5a2	A	T	7: 128,266,395		probably null	Het
Slco5a1	A	G	1: 12,990,122	V125A	probably benign	Het
Smu1	A	G	4: 40,748,600	V230A	probably benign	Het
Sp4	A	G	12: 118,254,404		probably null	Het
Stbd1	A	G	5: 92,605,557	K302R	probably damaging	Het
Stx2	A	T	5: 128,986,417	V268D	probably benign	Het
Tbc1d9b	G	A	11: 50,161,620	A885T	probably benign	Het
Tbce	T	A	13: 14,006,478	D267V	possibly damaging	Het
Tert	T	C	13: 73,627,606	Y159H	probably damaging	Het
Thbs2	T	A	17: 14,670,039	I1102F	possibly damaging	Het
Tmprss7	G	C	16: 45,683,510	A183G	probably benign	Het
Top3b	C	A	16: 16,887,721	P450Q	probably benign	Het
Trpm6	A	T	19: 18,750,045		probably null	Het
Ube4a	T	C	9: 44,925,973	D988G	probably damaging	Het
Vmn1r158	A	T	7: 22,790,300	S161R	probably benign	Het
Vps41	T	C	13: 18,841,252		probably null	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp617	T	A	8: 71,928,189		probably null	Het
Zfp808	C	T	13: 62,171,505	H183Y	probably benign	Het
Zfy1	A	T	Y: 725,496	C756*	probably null	Het
Zswim2	A	T	2: 83,915,607	Y496N	probably damaging	Het

Other mutations in Bicc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Bicc1	APN	10	70961157	missense	probably damaging	1.00
IGL01988:Bicc1	APN	10	70956176	missense	probably damaging	1.00
IGL02686:Bicc1	APN	10	70943360	splice site	probably benign
IGL02829:Bicc1	APN	10	70958880	missense	probably damaging	1.00
IGL03276:Bicc1	APN	10	70953438	missense	possibly damaging	0.76
IGL03354:Bicc1	APN	10	70946602	missense	probably benign	0.00
artemis	UTSW	10	71027954	missense	probably damaging	0.99
Pebbles	UTSW	10	70947900	missense	possibly damaging	0.95
PIT1430001:Bicc1	UTSW	10	70957681	missense	possibly damaging	0.94
R0095:Bicc1	UTSW	10	70961158	missense	probably damaging	1.00
R0142:Bicc1	UTSW	10	70925370	missense	probably damaging	1.00
R0184:Bicc1	UTSW	10	71079215	missense	probably benign
R0469:Bicc1	UTSW	10	71079215	missense	probably benign
R0485:Bicc1	UTSW	10	70925315	missense	probably damaging	0.96
R0520:Bicc1	UTSW	10	70957190	missense	probably damaging	0.96
R0884:Bicc1	UTSW	10	70958847	missense	probably damaging	1.00
R1678:Bicc1	UTSW	10	70943518	missense	probably damaging	1.00
R1892:Bicc1	UTSW	10	70958784	missense	probably damaging	1.00
R1943:Bicc1	UTSW	10	71159523	missense	probably damaging	1.00
R2220:Bicc1	UTSW	10	70950125	missense	probably damaging	1.00
R2240:Bicc1	UTSW	10	70946803	critical splice donor site	probably null
R2519:Bicc1	UTSW	10	70930644	missense	probably damaging	1.00
R4362:Bicc1	UTSW	10	70943374	frame shift	probably null
R4363:Bicc1	UTSW	10	70943374	frame shift	probably null
R4419:Bicc1	UTSW	10	70946974	missense	possibly damaging	0.73
R4697:Bicc1	UTSW	10	70953484	missense	possibly damaging	0.87
R4728:Bicc1	UTSW	10	70935831	critical splice donor site	probably null
R4765:Bicc1	UTSW	10	70940593	missense	probably damaging	1.00
R4838:Bicc1	UTSW	10	70945316	missense	possibly damaging	0.50
R5022:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5023:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5057:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5082:Bicc1	UTSW	10	70940522	missense	probably benign	0.05
R5160:Bicc1	UTSW	10	70932236	missense	probably damaging	1.00
R5294:Bicc1	UTSW	10	70947900	missense	possibly damaging	0.95
R5639:Bicc1	UTSW	10	70940520	missense	probably damaging	1.00
R5749:Bicc1	UTSW	10	70946969	missense	probably benign	0.00
R6045:Bicc1	UTSW	10	70957081	nonsense	probably null
R6128:Bicc1	UTSW	10	70940483	splice site	probably null
R6277:Bicc1	UTSW	10	71027901	missense	possibly damaging	0.74
R6389:Bicc1	UTSW	10	70958922	missense	probably damaging	1.00
R7021:Bicc1	UTSW	10	70961148	missense	probably damaging	0.99
R7101:Bicc1	UTSW	10	70930653	missense	probably damaging	1.00
R7351:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7352:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7353:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7366:Bicc1	UTSW	10	70943386	missense	probably benign	0.01
R7480:Bicc1	UTSW	10	70943476	missense	probably damaging	1.00
R7541:Bicc1	UTSW	10	70946604	missense	possibly damaging	0.82
R7544:Bicc1	UTSW	10	70956374	missense	possibly damaging	0.89
R7555:Bicc1	UTSW	10	70956291	missense	possibly damaging	0.75
R7663:Bicc1	UTSW	10	70946590	missense	probably benign
R7671:Bicc1	UTSW	10	70957167	missense	probably benign	0.01
R8129:Bicc1	UTSW	10	71079203	missense	probably benign	0.01
R8270:Bicc1	UTSW	10	70932108	missense	probably damaging	0.99
R8525:Bicc1	UTSW	10	70943535	missense	possibly damaging	0.67
R8762:Bicc1	UTSW	10	70943386	missense	probably benign	0.03
R8849:Bicc1	UTSW	10	70946864	missense	probably benign	0.23
R9120:Bicc1	UTSW	10	70941032	missense	probably damaging	1.00
R9164:Bicc1	UTSW	10	70945264	missense	probably damaging	1.00
R9368:Bicc1	UTSW	10	70950087	missense	probably benign	0.13
R9452:Bicc1	UTSW	10	70957151	missense	probably damaging	0.99
R9497:Bicc1	UTSW	10	70940998	critical splice donor site	probably null
R9641:Bicc1	UTSW	10	71027942	missense	probably benign	0.01
R9672:Bicc1	UTSW	10	70958836	missense	probably damaging	1.00
RF013:Bicc1	UTSW	10	70935830	critical splice donor site	probably null
X0028:Bicc1	UTSW	10	70945336	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGTGTTACCTGCACATGTC -3'
(R):5'- TGAAAGCTATCTCCTAAGCCTCTC -3'

Sequencing Primer
(F):5'- CTGCACATGTCCATTTATAGACGCAG -3'
(R):5'- AAGCTATCTCCTAAGCCTCTCTATGG -3'

Posted On

2019-11-26