Mutagenetix > Incidental Mutation

Incidental Mutation 'R7747:Gm11639'

596924

Institutional Source

Beutler Lab

Gene Symbol

Gm11639

Ensembl Gene

ENSMUSG00000040838

Gene Name

predicted gene 11639

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R7747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104685707-105117394 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 104842603 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 2011 (I2011S)

Ref Sequence

ENSEMBL: ENSMUSP00000148433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000212287]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000212287
AA Change: I2011S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (89/89)

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109A12Rik	G	A	5: 93,206,557		probably null	Het
2410004P03Rik	C	T	12: 17,007,148	S116N	probably damaging	Het
3425401B19Rik	T	C	14: 32,663,069	D313G	possibly damaging	Het
AA986860	A	G	1: 130,743,547	E502G	possibly damaging	Het
Adamts20	T	A	15: 94,291,587	K1462*	probably null	Het
Adgrg6	A	C	10: 14,450,577		probably null	Het
Ankrd13d	G	A	19: 4,280,985	H165Y	probably damaging	Het
Arap3	T	C	18: 37,988,888		probably null	Het
Arhgap33	A	G	7: 30,524,135	V823A	probably damaging	Het
Aup1	C	A	6: 83,054,795	P34T	unknown	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicc1	T	C	10: 70,946,993	T515A	probably benign	Het
Ccdc73	A	C	2: 104,929,556	K106Q	probably damaging	Het
Celsr3	G	A	9: 108,829,978	R1220Q	possibly damaging	Het
Cep290	C	T	10: 100,558,176	Q2082*	probably null	Het
Cercam	A	G	2: 29,871,286	D104G	probably benign	Het
Champ1	A	G	8: 13,879,990	H716R	probably damaging	Het
Cntrl	A	T	2: 35,116,798	I159F	probably damaging	Het
Col11a1	T	C	3: 114,102,572	I507T	unknown	Het
Cped1	T	C	6: 22,143,974	I573T	probably damaging	Het
Crot	C	T	5: 8,968,869		probably null	Het
D1Pas1	T	A	1: 186,968,677	S268T	probably benign	Het
Erich6	A	G	3: 58,618,928	V551A	probably damaging	Het
Fbxo32	T	C	15: 58,191,361	N192S	probably damaging	Het
Fgd6	T	C	10: 94,044,916	V544A	probably damaging	Het
Fnbp1	C	T	2: 31,036,147	G552E	probably damaging	Het
Gjb5	A	T	4: 127,356,162	V63D	probably damaging	Het
Gm10053	T	C	19: 24,876,039	I96T	probably benign	Het
Gm38119	T	C	3: 92,738,021	S89G	unknown	Het
Gm884	A	T	11: 103,614,255	S2296T	probably damaging	Het
Gpn2	A	G	4: 133,586,045	I183V	probably benign	Het
Greb1	C	T	12: 16,674,795	V1793M	probably benign	Het
H2-Q7	A	G	17: 35,440,061	I163V	probably benign	Het
Hrh2	T	C	13: 54,214,530	V175A	possibly damaging	Het
Hsd3b3	C	T	3: 98,743,898	V79I	possibly damaging	Het
Itgb7	T	C	15: 102,216,604	I727M	possibly damaging	Het
Kcnj16	T	A	11: 111,024,743	F77Y	probably damaging	Het
Lilra6	T	A	7: 3,912,996	Q288L	probably benign	Het
Malrd1	G	A	2: 16,074,835	V1788M	unknown	Het
Mau2	T	C	8: 70,026,723	I349V	possibly damaging	Het
Mbnl3	C	T	X: 51,130,334	R181H	probably damaging	Het
Mfsd6	T	C	1: 52,676,547	T524A	probably benign	Het
Mical2	G	T	7: 112,333,839	R740L	probably benign	Het
Mknk1	G	A	4: 115,878,072	C379Y	possibly damaging	Het
Mta3	A	T	17: 83,791,736	K410*	probably null	Het
Myb	A	C	10: 21,156,425	I19S	possibly damaging	Het
Ncor2	A	G	5: 125,027,038	F996S		Het
Nlrp1a	T	C	11: 71,123,408	M339V	possibly damaging	Het
Olfr136	C	T	17: 38,335,394	P79L	probably benign	Het
Olfr689	A	G	7: 105,314,447	K148E	probably damaging	Het
Pcdhga5	C	T	18: 37,696,782	T761I	possibly damaging	Het
Pcmtd2	T	C	2: 181,851,659	L219P	possibly damaging	Het
Pfdn1	C	T	18: 36,432,305		probably null	Het
Pkn3	G	A	2: 30,090,584	C829Y	probably benign	Het
Pld1	T	C	3: 28,087,189	S634P	possibly damaging	Het
Pofut2	T	G	10: 77,262,470	V139G	possibly damaging	Het
Prdm12	C	A	2: 31,653,871		probably null	Het
Prkar2b	C	A	12: 32,060,938	A49S	probably benign	Het
Prmt1	A	T	7: 44,984,136		probably null	Het
Rab39	A	T	9: 53,686,400	D188E	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Scgb1b19	A	G	7: 33,287,498	I25V	probably benign	Het
Scn9a	A	T	2: 66,484,298	I1692N	probably damaging	Het
Sdk1	G	T	5: 142,084,491	G1137V	probably damaging	Het
Sec16b	A	G	1: 157,565,472	T950A	possibly damaging	Het
Senp2	G	T	16: 22,038,622	R398L	probably damaging	Het
Sfswap	G	T	5: 129,550,593		probably null	Het
Sh3rf1	A	G	8: 61,353,753	T362A	probably damaging	Het
Slc17a1	A	T	13: 23,888,052	I418F	probably benign	Het
Slc1a4	A	T	11: 20,308,587	M284K	probably damaging	Het
Slc5a2	A	T	7: 128,266,395		probably null	Het
Slco5a1	A	G	1: 12,990,122	V125A	probably benign	Het
Smu1	A	G	4: 40,748,600	V230A	probably benign	Het
Sp4	A	G	12: 118,254,404		probably null	Het
Stbd1	A	G	5: 92,605,557	K302R	probably damaging	Het
Stx2	A	T	5: 128,986,417	V268D	probably benign	Het
Tbc1d9b	G	A	11: 50,161,620	A885T	probably benign	Het
Tbce	T	A	13: 14,006,478	D267V	possibly damaging	Het
Tert	T	C	13: 73,627,606	Y159H	probably damaging	Het
Thbs2	T	A	17: 14,670,039	I1102F	possibly damaging	Het
Tmprss7	G	C	16: 45,683,510	A183G	probably benign	Het
Top3b	C	A	16: 16,887,721	P450Q	probably benign	Het
Trpm6	A	T	19: 18,750,045		probably null	Het
Ube4a	T	C	9: 44,925,973	D988G	probably damaging	Het
Vmn1r158	A	T	7: 22,790,300	S161R	probably benign	Het
Vps41	T	C	13: 18,841,252		probably null	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp617	T	A	8: 71,928,189		probably null	Het
Zfp808	C	T	13: 62,171,505	H183Y	probably benign	Het
Zfy1	A	T	Y: 725,496	C756*	probably null	Het
Zswim2	A	T	2: 83,915,607	Y496N	probably damaging	Het

Other mutations in Gm11639

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Gm11639	APN	11	105100021	missense	probably damaging	1.00
IGL01308:Gm11639	APN	11	104720697	missense	probably benign	0.03
IGL01483:Gm11639	APN	11	104739347	missense	probably benign	0.03
IGL01695:Gm11639	APN	11	104736063	missense	probably damaging	1.00
IGL01860:Gm11639	APN	11	104690921	missense	probably benign	0.16
IGL01981:Gm11639	APN	11	104721432	intron	probably benign
IGL01984:Gm11639	APN	11	104738308	missense	probably benign	0.20
IGL02023:Gm11639	APN	11	104721432	intron	probably benign
IGL02252:Gm11639	APN	11	104753927	missense	possibly damaging	0.68
IGL02886:Gm11639	APN	11	105095874	missense	possibly damaging	0.95
IGL03116:Gm11639	APN	11	104721533	missense	probably benign	0.02
IGL03141:Gm11639	APN	11	105095870	missense	probably damaging	0.99
IGL03242:Gm11639	APN	11	105106404	missense	probably damaging	1.00
IGL03274:Gm11639	APN	11	104721093	missense	probably benign	0.03
IGL03408:Gm11639	APN	11	104710621	missense	probably benign	0.03
R0018:Gm11639	UTSW	11	104721552	critical splice donor site	probably null
R0068:Gm11639	UTSW	11	104720822	missense	probably benign	0.29
R0350:Gm11639	UTSW	11	104690880	missense	probably benign	0.03
R0646:Gm11639	UTSW	11	104720501	missense	probably benign	0.03
R0668:Gm11639	UTSW	11	104720492	missense	probably benign	0.16
R0715:Gm11639	UTSW	11	104720880	missense	possibly damaging	0.90
R0944:Gm11639	UTSW	11	104710730	splice site	probably null
R1330:Gm11639	UTSW	11	104746290	missense	possibly damaging	0.84
R1508:Gm11639	UTSW	11	104710677	missense	probably benign	0.03
R1643:Gm11639	UTSW	11	104698978	missense	probably benign	0.16
R1651:Gm11639	UTSW	11	104720666	missense	probably benign	0.03
R1665:Gm11639	UTSW	11	104721114	missense	probably benign	0.07
R1702:Gm11639	UTSW	11	104691006	missense	probably benign	0.03
R1711:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1779:Gm11639	UTSW	11	104720939	missense	probably benign	0.15
R1813:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1818:Gm11639	UTSW	11	104721507	missense	probably benign	0.10
R1896:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1969:Gm11639	UTSW	11	104746264	missense	probably damaging	1.00
R2139:Gm11639	UTSW	11	104751911	missense	possibly damaging	0.53
R2165:Gm11639	UTSW	11	104751862	missense	possibly damaging	0.93
R2359:Gm11639	UTSW	11	104739280	missense	possibly damaging	0.80
R2394:Gm11639	UTSW	11	104738295	missense	probably benign	0.17
R2406:Gm11639	UTSW	11	104720631	missense	probably benign	0.03
R2570:Gm11639	UTSW	11	104733664	missense	probably damaging	1.00
R3795:Gm11639	UTSW	11	104733675	missense	possibly damaging	0.94
R4352:Gm11639	UTSW	11	104739314	missense	probably null	0.25
R4359:Gm11639	UTSW	11	104733721	splice site	probably null
R4424:Gm11639	UTSW	11	104736114	critical splice donor site	probably null
R4895:Gm11639	UTSW	11	104720286	missense	probably benign	0.16
R4895:Gm11639	UTSW	11	104749670	missense	probably damaging	1.00
R5006:Gm11639	UTSW	11	104729677	splice site	probably null
R5066:Gm11639	UTSW	11	104720664	missense	probably benign	0.03
R5329:Gm11639	UTSW	11	104753806	splice site	probably null
R5405:Gm11639	UTSW	11	104721192	missense	probably benign	0.07
R5814:Gm11639	UTSW	11	104736114	critical splice donor site	probably benign
R5888:Gm11639	UTSW	11	104721401	splice site	probably benign
R5910:Gm11639	UTSW	11	104690934	missense	probably benign	0.01
R5975:Gm11639	UTSW	11	104687549	start gained	probably benign
R6019:Gm11639	UTSW	11	105042902	critical splice donor site	probably null
R6028:Gm11639	UTSW	11	104769655	critical splice donor site	probably null
R6048:Gm11639	UTSW	11	104944433	missense	unknown
R6059:Gm11639	UTSW	11	105036769	missense	probably benign	0.03
R6147:Gm11639	UTSW	11	104967740	missense	unknown
R6176:Gm11639	UTSW	11	104792557	missense	probably benign	0.16
R6181:Gm11639	UTSW	11	104831333	missense	probably benign	0.25
R6196:Gm11639	UTSW	11	104855560	missense	probably benign	0.07
R6245:Gm11639	UTSW	11	104785008	missense	probably benign	0.03
R6262:Gm11639	UTSW	11	104893753	missense	probably benign	0.24
R6263:Gm11639	UTSW	11	104919486	missense	unknown
R6277:Gm11639	UTSW	11	105010322	missense	possibly damaging	0.49
R6338:Gm11639	UTSW	11	104843208	nonsense	probably null
R6355:Gm11639	UTSW	11	105005685	missense	probably benign	0.29
R6356:Gm11639	UTSW	11	104893707	missense	probably benign	0.19
R6365:Gm11639	UTSW	11	104924586	missense	unknown
R6391:Gm11639	UTSW	11	104994317	missense	possibly damaging	0.92
R6556:Gm11639	UTSW	11	105008251	missense	probably null	0.03
R6604:Gm11639	UTSW	11	104698946	nonsense	probably null
R6605:Gm11639	UTSW	11	104999281	splice site	probably null
R6634:Gm11639	UTSW	11	104893783	missense	probably benign	0.17
R6851:Gm11639	UTSW	11	105005695	missense	probably benign	0.03
R6862:Gm11639	UTSW	11	104721458	nonsense	probably null
R6949:Gm11639	UTSW	11	104909070	missense	probably damaging	1.00
R6970:Gm11639	UTSW	11	104776356	missense	probably benign	0.03
R7014:Gm11639	UTSW	11	104693422	missense	probably benign	0.03
R7097:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R7122:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R7124:Gm11639	UTSW	11	104738274	missense	probably benign	0.17
R7146:Gm11639	UTSW	11	104967752	missense	unknown
R7146:Gm11639	UTSW	11	105022938	missense	probably benign	0.03
R7154:Gm11639	UTSW	11	104699140	splice site	probably null
R7175:Gm11639	UTSW	11	104947411	missense	unknown
R7198:Gm11639	UTSW	11	104751885	missense	probably benign	0.15
R7211:Gm11639	UTSW	11	104710713	missense	probably benign	0.01
R7211:Gm11639	UTSW	11	104724609	critical splice donor site	probably null
R7216:Gm11639	UTSW	11	104880549	missense	possibly damaging	0.49
R7221:Gm11639	UTSW	11	104900606	missense	probably benign	0.36
R7233:Gm11639	UTSW	11	104839843	missense	possibly damaging	0.69
R7236:Gm11639	UTSW	11	104899267	missense	probably benign	0.10
R7262:Gm11639	UTSW	11	104854606	critical splice donor site	probably null
R7289:Gm11639	UTSW	11	105038358	missense	probably benign	0.24
R7323:Gm11639	UTSW	11	105030011	missense	probably benign	0.07
R7378:Gm11639	UTSW	11	104714702	missense	probably benign	0.03
R7388:Gm11639	UTSW	11	104721045	missense	probably damaging	0.97
R7390:Gm11639	UTSW	11	104724585	missense	possibly damaging	0.46
R7411:Gm11639	UTSW	11	104999723	missense	probably benign	0.10
R7468:Gm11639	UTSW	11	104749700	missense	probably benign	0.17
R7497:Gm11639	UTSW	11	104762690	critical splice donor site	probably null
R7620:Gm11639	UTSW	11	104832143	missense	possibly damaging	0.95
R7638:Gm11639	UTSW	11	105036799	missense	probably benign	0.03
R7661:Gm11639	UTSW	11	104726677	missense	probably benign	0.03
R7667:Gm11639	UTSW	11	104751911	missense	possibly damaging	0.53
R7682:Gm11639	UTSW	11	104964348	splice site	probably null
R7708:Gm11639	UTSW	11	104964571	missense	unknown
R7721:Gm11639	UTSW	11	104724540	nonsense	probably null
R7840:Gm11639	UTSW	11	104733713	missense	probably benign	0.07
R7846:Gm11639	UTSW	11	104714745	critical splice donor site	probably null
R7893:Gm11639	UTSW	11	104979360	missense	unknown
R7897:Gm11639	UTSW	11	104998235	missense	probably benign	0.24
R7936:Gm11639	UTSW	11	104999698	missense	possibly damaging	0.89
R7936:Gm11639	UTSW	11	105046559	critical splice donor site	probably null
R7959:Gm11639	UTSW	11	105042801	missense	probably damaging	0.96
R8031:Gm11639	UTSW	11	104881469	missense	possibly damaging	0.49
R8041:Gm11639	UTSW	11	104919479	missense	unknown
R8054:Gm11639	UTSW	11	104730400	missense	probably benign	0.07
R8056:Gm11639	UTSW	11	104909070	missense	probably damaging	0.98
R8088:Gm11639	UTSW	11	104998246	missense	probably benign	0.10
R8112:Gm11639	UTSW	11	104950200	missense	unknown
R8340:Gm11639	UTSW	11	104986030	missense	unknown
R8405:Gm11639	UTSW	11	104721198	missense	probably benign	0.02
R8413:Gm11639	UTSW	11	104920309	missense	unknown
R8472:Gm11639	UTSW	11	104818637	missense	probably benign	0.07
R8549:Gm11639	UTSW	11	104999695	missense	probably damaging	0.99
R8699:Gm11639	UTSW	11	104781246	missense	probably benign	0.03
R8711:Gm11639	UTSW	11	104852545	missense	probably benign	0.03
R8732:Gm11639	UTSW	11	104804274	missense	probably benign	0.03
R8745:Gm11639	UTSW	11	104858478	missense	possibly damaging	0.57
R8806:Gm11639	UTSW	11	105037869	missense	probably benign	0.07
R8810:Gm11639	UTSW	11	104914895	missense	unknown
R8845:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R8870:Gm11639	UTSW	11	104900674	missense	probably benign	0.07
R8872:Gm11639	UTSW	11	104870054	missense	probably benign	0.19
R8879:Gm11639	UTSW	11	104690955	missense	probably benign	0.03
R8924:Gm11639	UTSW	11	104915427	frame shift	probably null
R8954:Gm11639	UTSW	11	105018699	critical splice donor site	probably null
R8960:Gm11639	UTSW	11	104929946	splice site	probably benign
R8975:Gm11639	UTSW	11	105063589	missense	probably benign	0.17
R8988:Gm11639	UTSW	11	105020526	missense	probably benign	0.07
R8998:Gm11639	UTSW	11	104749651	missense	probably benign	0.09
R8999:Gm11639	UTSW	11	104749651	missense	probably benign	0.09
R9002:Gm11639	UTSW	11	105029996	missense	probably damaging	0.99
R9012:Gm11639	UTSW	11	104820521	critical splice donor site	probably null
R9036:Gm11639	UTSW	11	105036775	missense	probably benign	0.03
R9037:Gm11639	UTSW	11	104912965	missense	unknown
R9059:Gm11639	UTSW	11	104751863	missense	possibly damaging	0.73
R9066:Gm11639	UTSW	11	104740862	intron	probably benign
R9122:Gm11639	UTSW	11	104965779	missense	unknown
R9125:Gm11639	UTSW	11	104845534	missense	probably damaging	1.00
R9127:Gm11639	UTSW	11	104850581	missense	probably benign	0.07
R9171:Gm11639	UTSW	11	104909882	missense	probably benign	0.36
R9219:Gm11639	UTSW	11	104945865	missense	unknown
R9224:Gm11639	UTSW	11	104770975	missense	probably benign	0.07
R9235:Gm11639	UTSW	11	105017161	missense	probably benign	0.19
R9294:Gm11639	UTSW	11	104831300	missense	probably benign	0.24
R9318:Gm11639	UTSW	11	104965822	critical splice donor site	probably null
R9322:Gm11639	UTSW	11	104874373	missense	probably benign	0.36
R9361:Gm11639	UTSW	11	105005698	missense	probably benign	0.03
R9408:Gm11639	UTSW	11	104730429	critical splice donor site	probably null
R9434:Gm11639	UTSW	11	105009037	missense	probably benign	0.24
R9477:Gm11639	UTSW	11	104945872	missense	unknown
R9658:Gm11639	UTSW	11	104720294	missense	probably benign	0.03
R9719:Gm11639	UTSW	11	104977086	missense	unknown
R9751:Gm11639	UTSW	11	104893085	missense	probably benign	0.19
R9763:Gm11639	UTSW	11	104999659	missense	possibly damaging	0.89
X0026:Gm11639	UTSW	11	104720975	missense	probably benign	0.07
Z1088:Gm11639	UTSW	11	104751902	missense	probably damaging	0.96
Z1176:Gm11639	UTSW	11	105001967	missense	probably benign	0.29
Z1177:Gm11639	UTSW	11	104739338	nonsense	probably null
Z1177:Gm11639	UTSW	11	104820518	missense	probably benign	0.03
Z1177:Gm11639	UTSW	11	104924019	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATCGCCATGTGGAAATTGTATC -3'
(R):5'- CAGTTGAACTTCCATTTAAAGGGG -3'

Sequencing Primer
(F):5'- TCATTACTGATACAGATGGGTAGGC -3'
(R):5'- AAGGGGAGTTACTAGAAATTTGTTC -3'

Posted On

2019-11-26