Mutagenetix > Incidental Mutation

Incidental Mutation 'R7747:Greb1'

596926

Institutional Source

Beutler Lab

Gene Symbol

Greb1

Ensembl Gene

ENSMUSG00000036523

Gene Name

gene regulated by estrogen in breast cancer protein

Synonyms

5730583K22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16670615-16800886 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 16674795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1793 (V1793M)

Ref Sequence

ENSEMBL: ENSMUSP00000044454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]

AlphaFold

Q3UHK3

Predicted Effect

probably benign
Transcript: ENSMUST00000048064
AA Change: V1793M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: V1793M

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1954	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159120
AA Change: V1765M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: V1765M

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1100	1118	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1596	1607	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162112
AA Change: V1793M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: V1793M

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1128	1146	N/A	INTRINSIC
low complexity region	1224	1235	N/A	INTRINSIC
low complexity region	1279	1293	N/A	INTRINSIC
low complexity region	1624	1635	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (89/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109A12Rik	G	A	5: 93,206,557		probably null	Het
2410004P03Rik	C	T	12: 17,007,148	S116N	probably damaging	Het
3425401B19Rik	T	C	14: 32,663,069	D313G	possibly damaging	Het
AA986860	A	G	1: 130,743,547	E502G	possibly damaging	Het
Adamts20	T	A	15: 94,291,587	K1462*	probably null	Het
Adgrg6	A	C	10: 14,450,577		probably null	Het
Ankrd13d	G	A	19: 4,280,985	H165Y	probably damaging	Het
Arap3	T	C	18: 37,988,888		probably null	Het
Arhgap33	A	G	7: 30,524,135	V823A	probably damaging	Het
Aup1	C	A	6: 83,054,795	P34T	unknown	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicc1	T	C	10: 70,946,993	T515A	probably benign	Het
Ccdc73	A	C	2: 104,929,556	K106Q	probably damaging	Het
Celsr3	G	A	9: 108,829,978	R1220Q	possibly damaging	Het
Cep290	C	T	10: 100,558,176	Q2082*	probably null	Het
Cercam	A	G	2: 29,871,286	D104G	probably benign	Het
Champ1	A	G	8: 13,879,990	H716R	probably damaging	Het
Cntrl	A	T	2: 35,116,798	I159F	probably damaging	Het
Col11a1	T	C	3: 114,102,572	I507T	unknown	Het
Cped1	T	C	6: 22,143,974	I573T	probably damaging	Het
Crot	C	T	5: 8,968,869		probably null	Het
D1Pas1	T	A	1: 186,968,677	S268T	probably benign	Het
Erich6	A	G	3: 58,618,928	V551A	probably damaging	Het
Fbxo32	T	C	15: 58,191,361	N192S	probably damaging	Het
Fgd6	T	C	10: 94,044,916	V544A	probably damaging	Het
Fnbp1	C	T	2: 31,036,147	G552E	probably damaging	Het
Gjb5	A	T	4: 127,356,162	V63D	probably damaging	Het
Gm10053	T	C	19: 24,876,039	I96T	probably benign	Het
Gm11639	T	G	11: 104,842,603	I2011S	probably damaging	Het
Gm38119	T	C	3: 92,738,021	S89G	unknown	Het
Gm884	A	T	11: 103,614,255	S2296T	probably damaging	Het
Gpn2	A	G	4: 133,586,045	I183V	probably benign	Het
H2-Q7	A	G	17: 35,440,061	I163V	probably benign	Het
Hrh2	T	C	13: 54,214,530	V175A	possibly damaging	Het
Hsd3b3	C	T	3: 98,743,898	V79I	possibly damaging	Het
Itgb7	T	C	15: 102,216,604	I727M	possibly damaging	Het
Kcnj16	T	A	11: 111,024,743	F77Y	probably damaging	Het
Lilra6	T	A	7: 3,912,996	Q288L	probably benign	Het
Malrd1	G	A	2: 16,074,835	V1788M	unknown	Het
Mau2	T	C	8: 70,026,723	I349V	possibly damaging	Het
Mbnl3	C	T	X: 51,130,334	R181H	probably damaging	Het
Mfsd6	T	C	1: 52,676,547	T524A	probably benign	Het
Mical2	G	T	7: 112,333,839	R740L	probably benign	Het
Mknk1	G	A	4: 115,878,072	C379Y	possibly damaging	Het
Mta3	A	T	17: 83,791,736	K410*	probably null	Het
Myb	A	C	10: 21,156,425	I19S	possibly damaging	Het
Ncor2	A	G	5: 125,027,038	F996S		Het
Nlrp1a	T	C	11: 71,123,408	M339V	possibly damaging	Het
Olfr136	C	T	17: 38,335,394	P79L	probably benign	Het
Olfr689	A	G	7: 105,314,447	K148E	probably damaging	Het
Pcdhga5	C	T	18: 37,696,782	T761I	possibly damaging	Het
Pcmtd2	T	C	2: 181,851,659	L219P	possibly damaging	Het
Pfdn1	C	T	18: 36,432,305		probably null	Het
Pkn3	G	A	2: 30,090,584	C829Y	probably benign	Het
Pld1	T	C	3: 28,087,189	S634P	possibly damaging	Het
Pofut2	T	G	10: 77,262,470	V139G	possibly damaging	Het
Prdm12	C	A	2: 31,653,871		probably null	Het
Prkar2b	C	A	12: 32,060,938	A49S	probably benign	Het
Prmt1	A	T	7: 44,984,136		probably null	Het
Rab39	A	T	9: 53,686,400	D188E	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Scgb1b19	A	G	7: 33,287,498	I25V	probably benign	Het
Scn9a	A	T	2: 66,484,298	I1692N	probably damaging	Het
Sdk1	G	T	5: 142,084,491	G1137V	probably damaging	Het
Sec16b	A	G	1: 157,565,472	T950A	possibly damaging	Het
Senp2	G	T	16: 22,038,622	R398L	probably damaging	Het
Sfswap	G	T	5: 129,550,593		probably null	Het
Sh3rf1	A	G	8: 61,353,753	T362A	probably damaging	Het
Slc17a1	A	T	13: 23,888,052	I418F	probably benign	Het
Slc1a4	A	T	11: 20,308,587	M284K	probably damaging	Het
Slc5a2	A	T	7: 128,266,395		probably null	Het
Slco5a1	A	G	1: 12,990,122	V125A	probably benign	Het
Smu1	A	G	4: 40,748,600	V230A	probably benign	Het
Sp4	A	G	12: 118,254,404		probably null	Het
Stbd1	A	G	5: 92,605,557	K302R	probably damaging	Het
Stx2	A	T	5: 128,986,417	V268D	probably benign	Het
Tbc1d9b	G	A	11: 50,161,620	A885T	probably benign	Het
Tbce	T	A	13: 14,006,478	D267V	possibly damaging	Het
Tert	T	C	13: 73,627,606	Y159H	probably damaging	Het
Thbs2	T	A	17: 14,670,039	I1102F	possibly damaging	Het
Tmprss7	G	C	16: 45,683,510	A183G	probably benign	Het
Top3b	C	A	16: 16,887,721	P450Q	probably benign	Het
Trpm6	A	T	19: 18,750,045		probably null	Het
Ube4a	T	C	9: 44,925,973	D988G	probably damaging	Het
Vmn1r158	A	T	7: 22,790,300	S161R	probably benign	Het
Vps41	T	C	13: 18,841,252		probably null	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp617	T	A	8: 71,928,189		probably null	Het
Zfp808	C	T	13: 62,171,505	H183Y	probably benign	Het
Zfy1	A	T	Y: 725,496	C756*	probably null	Het
Zswim2	A	T	2: 83,915,607	Y496N	probably damaging	Het

Other mutations in Greb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Greb1	APN	12	16711961	missense	probably damaging	1.00
IGL01316:Greb1	APN	12	16698586	missense	probably benign	0.04
IGL01464:Greb1	APN	12	16714826	missense	probably damaging	0.99
IGL01474:Greb1	APN	12	16684501	missense	probably benign
IGL01522:Greb1	APN	12	16701201	missense	probably damaging	1.00
IGL01824:Greb1	APN	12	16711716	nonsense	probably null
IGL01837:Greb1	APN	12	16684451	missense	probably benign	0.19
IGL01991:Greb1	APN	12	16699681	missense	probably damaging	1.00
IGL01996:Greb1	APN	12	16690845	missense	possibly damaging	0.70
IGL02213:Greb1	APN	12	16706232	missense	probably damaging	1.00
IGL02267:Greb1	APN	12	16717208	missense	probably benign	0.00
IGL02512:Greb1	APN	12	16692712	missense	possibly damaging	0.79
IGL02583:Greb1	APN	12	16706295	splice site	probably benign
IGL02613:Greb1	APN	12	16739888	critical splice donor site	probably null
IGL02648:Greb1	APN	12	16708682	missense	probably damaging	1.00
IGL02679:Greb1	APN	12	16708723	missense	probably damaging	1.00
begraben	UTSW	12	16684373	missense	possibly damaging	0.51
Eared	UTSW	12	16673863	missense	probably damaging	1.00
Humpback	UTSW	12	16701171	missense	probably damaging	1.00
pied_billed	UTSW	12	16724857	missense	possibly damaging	0.79
rednecked	UTSW	12	16682152	missense	probably damaging	0.99
G1patch:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
IGL03048:Greb1	UTSW	12	16733331	missense	probably damaging	1.00
R0083:Greb1	UTSW	12	16696451	missense	probably benign
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0220:Greb1	UTSW	12	16682286	missense	probably damaging	1.00
R0245:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0540:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0547:Greb1	UTSW	12	16723411	missense	probably benign
R0563:Greb1	UTSW	12	16680267	missense	probably benign	0.23
R0607:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0610:Greb1	UTSW	12	16696442	missense	probably benign
R0652:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0659:Greb1	UTSW	12	16680212	missense	probably damaging	0.99
R0945:Greb1	UTSW	12	16673802	missense	probably benign	0.31
R1055:Greb1	UTSW	12	16682251	missense	probably damaging	0.98
R1445:Greb1	UTSW	12	16707851	missense	probably damaging	1.00
R1471:Greb1	UTSW	12	16711774	missense	probably damaging	0.97
R1503:Greb1	UTSW	12	16724819	nonsense	probably null
R1566:Greb1	UTSW	12	16711828	missense	possibly damaging	0.94
R1614:Greb1	UTSW	12	16701171	missense	probably damaging	1.00
R1623:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R1751:Greb1	UTSW	12	16723438	splice site	probably benign
R1778:Greb1	UTSW	12	16690894	missense	probably benign
R1842:Greb1	UTSW	12	16696243	missense	probably damaging	1.00
R2040:Greb1	UTSW	12	16702650	missense	probably damaging	1.00
R2153:Greb1	UTSW	12	16699532	missense	probably damaging	1.00
R2178:Greb1	UTSW	12	16696387	missense	probably damaging	1.00
R2194:Greb1	UTSW	12	16690908	missense	probably benign	0.08
R2248:Greb1	UTSW	12	16680378	missense	possibly damaging	0.90
R2474:Greb1	UTSW	12	16714953	missense	possibly damaging	0.93
R2509:Greb1	UTSW	12	16724922	missense	probably damaging	1.00
R2860:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2861:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2862:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2866:Greb1	UTSW	12	16699550	missense	probably damaging	1.00
R2890:Greb1	UTSW	12	16704478	missense	probably damaging	1.00
R3056:Greb1	UTSW	12	16688591	missense	probably damaging	0.96
R3863:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3864:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3956:Greb1	UTSW	12	16682299	missense	probably damaging	1.00
R4493:Greb1	UTSW	12	16698610	missense	probably benign	0.14
R4548:Greb1	UTSW	12	16699675	missense	probably damaging	1.00
R4683:Greb1	UTSW	12	16711773	missense	possibly damaging	0.75
R4739:Greb1	UTSW	12	16696328	missense	probably damaging	1.00
R4770:Greb1	UTSW	12	16681356	missense	probably benign	0.03
R4838:Greb1	UTSW	12	16684360	critical splice donor site	probably null
R4925:Greb1	UTSW	12	16681471	missense	probably damaging	1.00
R4982:Greb1	UTSW	12	16724761	missense	probably damaging	0.98
R5009:Greb1	UTSW	12	16724857	missense	possibly damaging	0.79
R5086:Greb1	UTSW	12	16708022	intron	probably benign
R5213:Greb1	UTSW	12	16714790	nonsense	probably null
R5310:Greb1	UTSW	12	16716759	missense	probably benign	0.09
R5353:Greb1	UTSW	12	16688566	nonsense	probably null
R5544:Greb1	UTSW	12	16673796	missense	probably damaging	1.00
R5605:Greb1	UTSW	12	16708726	missense	probably damaging	0.96
R5708:Greb1	UTSW	12	16673842	missense	probably benign	0.11
R5837:Greb1	UTSW	12	16688585	missense	probably damaging	1.00
R5890:Greb1	UTSW	12	16733421	missense	possibly damaging	0.90
R5938:Greb1	UTSW	12	16717258	missense	probably damaging	1.00
R6049:Greb1	UTSW	12	16681394	missense	probably damaging	0.99
R6093:Greb1	UTSW	12	16684486	missense	probably benign
R6120:Greb1	UTSW	12	16708621	missense	probably damaging	0.99
R6175:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R6247:Greb1	UTSW	12	16716675	missense	probably damaging	1.00
R6274:Greb1	UTSW	12	16735151	missense	probably damaging	0.97
R6376:Greb1	UTSW	12	16699579	missense	probably damaging	0.97
R6523:Greb1	UTSW	12	16684373	missense	possibly damaging	0.51
R6557:Greb1	UTSW	12	16710383	missense	probably benign	0.00
R6602:Greb1	UTSW	12	16709440	missense	probably benign	0.44
R6621:Greb1	UTSW	12	16692717	missense	probably damaging	1.00
R6645:Greb1	UTSW	12	16698579	missense	probably benign	0.07
R6725:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
R6750:Greb1	UTSW	12	16688583	missense	probably benign	0.05
R6863:Greb1	UTSW	12	16684420	missense	probably damaging	1.00
R6914:Greb1	UTSW	12	16707902	missense	probably damaging	0.97
R6996:Greb1	UTSW	12	16723354	missense	probably benign	0.00
R7083:Greb1	UTSW	12	16723314	missense	probably benign
R7147:Greb1	UTSW	12	16733427	missense	probably damaging	1.00
R7238:Greb1	UTSW	12	16674672	missense	probably damaging	0.99
R7290:Greb1	UTSW	12	16711738	missense	probably damaging	1.00
R7358:Greb1	UTSW	12	16724881	missense	probably damaging	1.00
R7395:Greb1	UTSW	12	16709430	critical splice donor site	probably null
R7526:Greb1	UTSW	12	16716765	missense	probably benign	0.00
R7530:Greb1	UTSW	12	16717206	missense	probably benign	0.02
R7536:Greb1	UTSW	12	16682185	missense	probably damaging	1.00
R7643:Greb1	UTSW	12	16711996	missense	probably damaging	0.99
R7732:Greb1	UTSW	12	16673863	missense	probably damaging	1.00
R7740:Greb1	UTSW	12	16740121	start gained	probably benign
R7760:Greb1	UTSW	12	16723416	missense	probably benign
R7937:Greb1	UTSW	12	16716669	missense	probably damaging	0.99
R8043:Greb1	UTSW	12	16711789	missense	probably damaging	1.00
R8259:Greb1	UTSW	12	16724924	nonsense	probably null
R8553:Greb1	UTSW	12	16723327	missense	probably benign	0.00
R8559:Greb1	UTSW	12	16696435	missense	probably damaging	1.00
R8690:Greb1	UTSW	12	16696547	missense	probably benign	0.03
R8830:Greb1	UTSW	12	16688519	missense	probably benign	0.35
R8911:Greb1	UTSW	12	16690902	missense	possibly damaging	0.84
R8963:Greb1	UTSW	12	16724884	missense	probably damaging	1.00
R8986:Greb1	UTSW	12	16684456	missense	probably damaging	0.99
R9013:Greb1	UTSW	12	16739969	missense	probably damaging	1.00
R9279:Greb1	UTSW	12	16682152	missense	probably damaging	0.99
R9360:Greb1	UTSW	12	16740036	missense	probably damaging	1.00
R9563:Greb1	UTSW	12	16724823	missense	probably benign	0.06
R9616:Greb1	UTSW	12	16740037	missense	probably damaging	1.00
R9627:Greb1	UTSW	12	16706166	missense	probably damaging	1.00
R9731:Greb1	UTSW	12	16688597	missense	probably damaging	1.00
R9761:Greb1	UTSW	12	16701274	missense	probably benign	0.05
Z1176:Greb1	UTSW	12	16696756	missense	probably benign	0.00
Z1177:Greb1	UTSW	12	16702491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTCAGGTAGCAGTCTACAGAC -3'
(R):5'- GCAAGTGAAGCTAGCTGTTG -3'

Sequencing Primer
(F):5'- TCTACAGACAACACGGGGTG -3'
(R):5'- GAACTCAGAACCCCCTGTTTGG -3'

Posted On

2019-11-26