Incidental Mutation 'R7747:Tbce'
ID 596929
Institutional Source Beutler Lab
Gene Symbol Tbce
Ensembl Gene ENSMUSG00000039233
Gene Name tubulin-specific chaperone E
Synonyms 2610206D02Rik, C530005D02Rik
MMRRC Submission 045803-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7747 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 14172534-14214223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14181063 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 267 (D267V)
Ref Sequence ENSEMBL: ENSMUSP00000047880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039894] [ENSMUST00000159893] [ENSMUST00000162326]
AlphaFold Q8CIV8
PDB Structure Solution structure of the C-terminal ubiquitin-like domain of mouse tubulin-specific chaperone e [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039894
AA Change: D267V

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047880
Gene: ENSMUSG00000039233
AA Change: D267V

DomainStartEndE-ValueType
CAP_GLY 10 76 5.23e-32 SMART
SCOP:d1fqva2 117 345 4e-20 SMART
low complexity region 347 360 N/A INTRINSIC
Pfam:Ubiquitin_2 442 523 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159893
SMART Domains Protein: ENSMUSP00000125244
Gene: ENSMUSG00000039233

DomainStartEndE-ValueType
SCOP:d1lpla_ 9 35 3e-5 SMART
Blast:CAP_GLY 10 34 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162326
AA Change: D267V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125613
Gene: ENSMUSG00000039233
AA Change: D267V

DomainStartEndE-ValueType
CAP_GLY 10 76 5.23e-32 SMART
SCOP:d1fqva2 117 345 4e-21 SMART
low complexity region 347 360 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: This gene encodes a tubulin binding cofactor that participates in microtubule dynamics. A mouse model of progressive motor neuropathy (pmn) was discovered to harbor a single amino acid deletion in this gene. Mice that are homozygous for pmn allele exhibit progressive atrophy and premature death due to respiratory failure. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit progressive caudal-cranial motor neuron degeneration, beginning around 3 weeks and culminating in death due to respiratory paralysis by 7 weeks. The sciatic and phrenic nerves are especially affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik G A 5: 93,354,416 (GRCm39) probably null Het
2410004P03Rik C T 12: 17,057,149 (GRCm39) S116N probably damaging Het
3425401B19Rik T C 14: 32,385,026 (GRCm39) D313G possibly damaging Het
AA986860 A G 1: 130,671,284 (GRCm39) E502G possibly damaging Het
Adamts20 T A 15: 94,189,468 (GRCm39) K1462* probably null Het
Adgrg6 A C 10: 14,326,321 (GRCm39) probably null Het
Ankrd13d G A 19: 4,331,013 (GRCm39) H165Y probably damaging Het
Arap3 T C 18: 38,121,941 (GRCm39) probably null Het
Arhgap33 A G 7: 30,223,560 (GRCm39) V823A probably damaging Het
Aup1 C A 6: 83,031,776 (GRCm39) P34T unknown Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bicc1 T C 10: 70,782,823 (GRCm39) T515A probably benign Het
Ccdc73 A C 2: 104,759,901 (GRCm39) K106Q probably damaging Het
Celsr3 G A 9: 108,707,177 (GRCm39) R1220Q possibly damaging Het
Cep290 C T 10: 100,394,038 (GRCm39) Q2082* probably null Het
Cercam A G 2: 29,761,298 (GRCm39) D104G probably benign Het
Champ1 A G 8: 13,929,990 (GRCm39) H716R probably damaging Het
Cntrl A T 2: 35,006,810 (GRCm39) I159F probably damaging Het
Col11a1 T C 3: 113,896,221 (GRCm39) I507T unknown Het
Cped1 T C 6: 22,143,973 (GRCm39) I573T probably damaging Het
Crot C T 5: 9,018,869 (GRCm39) probably null Het
D1Pas1 T A 1: 186,700,874 (GRCm39) S268T probably benign Het
Efcab3 T G 11: 104,733,429 (GRCm39) I2011S probably damaging Het
Erich6 A G 3: 58,526,349 (GRCm39) V551A probably damaging Het
Fbxo32 T C 15: 58,054,757 (GRCm39) N192S probably damaging Het
Fgd6 T C 10: 93,880,778 (GRCm39) V544A probably damaging Het
Fnbp1 C T 2: 30,926,159 (GRCm39) G552E probably damaging Het
Gjb5 A T 4: 127,249,955 (GRCm39) V63D probably damaging Het
Gm10053 T C 19: 24,853,403 (GRCm39) I96T probably benign Het
Gm38119 T C 3: 92,645,328 (GRCm39) S89G unknown Het
Gpn2 A G 4: 133,313,356 (GRCm39) I183V probably benign Het
Greb1 C T 12: 16,724,796 (GRCm39) V1793M probably benign Het
H2-Q7 A G 17: 35,659,037 (GRCm39) I163V probably benign Het
Hrh2 T C 13: 54,368,549 (GRCm39) V175A possibly damaging Het
Hsd3b3 C T 3: 98,651,214 (GRCm39) V79I possibly damaging Het
Itgb7 T C 15: 102,125,039 (GRCm39) I727M possibly damaging Het
Kcnj16 T A 11: 110,915,569 (GRCm39) F77Y probably damaging Het
Lilra6 T A 7: 3,915,995 (GRCm39) Q288L probably benign Het
Lrrc37 A T 11: 103,505,081 (GRCm39) S2296T probably damaging Het
Malrd1 G A 2: 16,079,646 (GRCm39) V1788M unknown Het
Mau2 T C 8: 70,479,373 (GRCm39) I349V possibly damaging Het
Mbnl3 C T X: 50,219,211 (GRCm39) R181H probably damaging Het
Mfsd6 T C 1: 52,715,706 (GRCm39) T524A probably benign Het
Mical2 G T 7: 111,933,046 (GRCm39) R740L probably benign Het
Mknk1 G A 4: 115,735,269 (GRCm39) C379Y possibly damaging Het
Mta3 A T 17: 84,099,165 (GRCm39) K410* probably null Het
Myb A C 10: 21,032,324 (GRCm39) I19S possibly damaging Het
Ncor2 A G 5: 125,104,102 (GRCm39) F996S Het
Nlrp1a T C 11: 71,014,234 (GRCm39) M339V possibly damaging Het
Or2n1d C T 17: 38,646,285 (GRCm39) P79L probably benign Het
Or56b35 A G 7: 104,963,654 (GRCm39) K148E probably damaging Het
Pcdhga5 C T 18: 37,829,835 (GRCm39) T761I possibly damaging Het
Pcmtd2 T C 2: 181,493,452 (GRCm39) L219P possibly damaging Het
Pfdn1 C T 18: 36,565,358 (GRCm39) probably null Het
Pkn3 G A 2: 29,980,596 (GRCm39) C829Y probably benign Het
Pld1 T C 3: 28,141,338 (GRCm39) S634P possibly damaging Het
Pofut2 T G 10: 77,098,304 (GRCm39) V139G possibly damaging Het
Prdm12 C A 2: 31,543,883 (GRCm39) probably null Het
Prkar2b C A 12: 32,110,937 (GRCm39) A49S probably benign Het
Prmt1 A T 7: 44,633,560 (GRCm39) probably null Het
Rab39 A T 9: 53,597,700 (GRCm39) D188E probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Scgb1b19 A G 7: 32,986,923 (GRCm39) I25V probably benign Het
Scn9a A T 2: 66,314,642 (GRCm39) I1692N probably damaging Het
Sdk1 G T 5: 142,070,246 (GRCm39) G1137V probably damaging Het
Sec16b A G 1: 157,393,042 (GRCm39) T950A possibly damaging Het
Senp2 G T 16: 21,857,372 (GRCm39) R398L probably damaging Het
Sfswap G T 5: 129,627,657 (GRCm39) probably null Het
Sh3rf1 A G 8: 61,806,787 (GRCm39) T362A probably damaging Het
Slc17a1 A T 13: 24,072,035 (GRCm39) I418F probably benign Het
Slc1a4 A T 11: 20,258,587 (GRCm39) M284K probably damaging Het
Slc5a2 A T 7: 127,865,567 (GRCm39) probably null Het
Slco5a1 A G 1: 13,060,346 (GRCm39) V125A probably benign Het
Smu1 A G 4: 40,748,600 (GRCm39) V230A probably benign Het
Sp4 A G 12: 118,218,139 (GRCm39) probably null Het
Stbd1 A G 5: 92,753,416 (GRCm39) K302R probably damaging Het
Stx2 A T 5: 129,063,481 (GRCm39) V268D probably benign Het
Tbc1d9b G A 11: 50,052,447 (GRCm39) A885T probably benign Het
Tert T C 13: 73,775,725 (GRCm39) Y159H probably damaging Het
Thbs2 T A 17: 14,890,301 (GRCm39) I1102F possibly damaging Het
Tmprss7 G C 16: 45,503,873 (GRCm39) A183G probably benign Het
Top3b C A 16: 16,705,585 (GRCm39) P450Q probably benign Het
Trpm6 A T 19: 18,727,409 (GRCm39) probably null Het
Ube4a T C 9: 44,837,271 (GRCm39) D988G probably damaging Het
Vmn1r158 A T 7: 22,489,725 (GRCm39) S161R probably benign Het
Vps41 T C 13: 19,025,422 (GRCm39) probably null Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp617 T A 8: 72,682,033 (GRCm39) probably null Het
Zfp808 C T 13: 62,319,319 (GRCm39) H183Y probably benign Het
Zfy1 A T Y: 725,496 (GRCm39) C756* probably null Het
Zswim2 A T 2: 83,745,951 (GRCm39) Y496N probably damaging Het
Other mutations in Tbce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Tbce APN 13 14,184,325 (GRCm39) splice site probably benign
IGL01405:Tbce APN 13 14,178,280 (GRCm39) missense probably damaging 1.00
IGL03142:Tbce APN 13 14,194,449 (GRCm39) missense possibly damaging 0.90
R0362:Tbce UTSW 13 14,172,747 (GRCm39) missense probably benign 0.12
R1736:Tbce UTSW 13 14,184,227 (GRCm39) missense possibly damaging 0.64
R1845:Tbce UTSW 13 14,194,294 (GRCm39) missense probably benign 0.22
R4445:Tbce UTSW 13 14,172,980 (GRCm39) missense possibly damaging 0.82
R4803:Tbce UTSW 13 14,194,446 (GRCm39) missense probably damaging 1.00
R4860:Tbce UTSW 13 14,194,380 (GRCm39) missense probably damaging 0.97
R4860:Tbce UTSW 13 14,194,380 (GRCm39) missense probably damaging 0.97
R4862:Tbce UTSW 13 14,173,004 (GRCm39) missense possibly damaging 0.94
R5096:Tbce UTSW 13 14,203,990 (GRCm39) splice site probably benign
R5391:Tbce UTSW 13 14,180,550 (GRCm39) missense probably damaging 0.99
R6050:Tbce UTSW 13 14,173,019 (GRCm39) missense possibly damaging 0.82
R6179:Tbce UTSW 13 14,194,362 (GRCm39) missense probably benign
R6645:Tbce UTSW 13 14,179,814 (GRCm39) missense probably benign 0.04
R7062:Tbce UTSW 13 14,194,380 (GRCm39) missense possibly damaging 0.89
R7222:Tbce UTSW 13 14,172,735 (GRCm39) missense probably damaging 1.00
R7572:Tbce UTSW 13 14,185,172 (GRCm39) missense probably benign
R7587:Tbce UTSW 13 14,194,327 (GRCm39) missense probably damaging 1.00
R7726:Tbce UTSW 13 14,203,875 (GRCm39) missense probably damaging 1.00
R8846:Tbce UTSW 13 14,194,285 (GRCm39) critical splice donor site probably null
R9185:Tbce UTSW 13 14,173,027 (GRCm39) missense probably damaging 1.00
R9299:Tbce UTSW 13 14,194,398 (GRCm39) missense probably benign 0.00
R9337:Tbce UTSW 13 14,194,398 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTAATTACAATTCCCCACGGG -3'
(R):5'- ATAGGGTCCTGACTGCAAGC -3'

Sequencing Primer
(F):5'- GACTTGCCCAGTTTAGGAGC -3'
(R):5'- TAGGGTCCTGACTGCAAGCATTTC -3'
Posted On 2019-11-26