Incidental Mutation 'R0632:C8a'
ID 59693
Institutional Source Beutler Lab
Gene Symbol C8a
Ensembl Gene ENSMUSG00000035031
Gene Name complement component 8, alpha polypeptide
Synonyms
MMRRC Submission 038821-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0632 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 104815679-104876398 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104856492 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 147 (D147G)
Ref Sequence ENSEMBL: ENSMUSP00000102420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048947] [ENSMUST00000064873] [ENSMUST00000106808] [ENSMUST00000179793]
AlphaFold Q8K182
Predicted Effect probably damaging
Transcript: ENSMUST00000048947
AA Change: D191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047606
Gene: ENSMUSG00000035031
AA Change: D191G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 41 91 1.33e-1 SMART
LDLa 95 132 2.07e-11 SMART
MACPF 288 492 5.26e-58 SMART
Blast:EGF 496 529 3e-13 BLAST
Blast:TSP1 545 573 3e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000064873
AA Change: D191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067541
Gene: ENSMUSG00000035031
AA Change: D191G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 41 91 1.33e-1 SMART
LDLa 95 132 2.07e-11 SMART
MACPF 288 492 5.26e-58 SMART
Blast:EGF 496 529 4e-13 BLAST
TSP1 545 587 1.86e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106808
AA Change: D147G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102420
Gene: ENSMUSG00000035031
AA Change: D147G

DomainStartEndE-ValueType
Blast:TSP1 4 47 3e-15 BLAST
LDLa 51 88 2.07e-11 SMART
MACPF 244 448 5.26e-58 SMART
Blast:EGF 452 485 4e-13 BLAST
Blast:TSP1 501 543 3e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152146
Predicted Effect probably benign
Transcript: ENSMUST00000179793
Meta Mutation Damage Score 0.2084 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the alpha subunit, which associates with the beta and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the beta subunit. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,227,618 D83G probably benign Het
Acaa1a T A 9: 119,347,818 probably benign Het
Adgrg7 T A 16: 56,742,589 T462S possibly damaging Het
Akap6 A T 12: 52,937,148 N825I probably damaging Het
Ankib1 T A 5: 3,772,529 N59I probably benign Het
Anks6 T C 4: 47,033,167 S633G possibly damaging Het
Ap4e1 C A 2: 127,049,280 Y522* probably null Het
Art5 G A 7: 102,097,957 T205I probably damaging Het
Ascc2 T A 11: 4,649,855 L176H probably damaging Het
Atp13a5 T C 16: 29,298,208 D529G probably benign Het
C2cd4a T C 9: 67,831,563 E66G probably benign Het
Ccdc109b T C 3: 129,918,726 M167V probably benign Het
Ccdc14 T C 16: 34,721,649 V532A possibly damaging Het
Ccdc88a T A 11: 29,482,749 probably benign Het
Cfap54 C T 10: 92,885,096 E2543K unknown Het
Cldn13 C T 5: 134,914,747 E195K probably benign Het
Cp A G 3: 19,971,082 S402G probably null Het
Cpa3 T C 3: 20,225,194 T194A probably benign Het
Crygf C A 1: 65,927,997 Y93* probably null Het
Ctsh A G 9: 90,061,582 R87G possibly damaging Het
Cyp2t4 A G 7: 27,158,246 D428G possibly damaging Het
Dnah17 C G 11: 118,067,682 probably benign Het
Dnah3 A G 7: 119,967,905 V2366A probably benign Het
Dscaml1 A T 9: 45,732,134 I1284F probably benign Het
Dsg1c T C 18: 20,272,346 probably benign Het
Dst G T 1: 34,271,413 R4098L probably damaging Het
Efhb A G 17: 53,413,459 probably benign Het
Epha7 A T 4: 28,821,104 I90F probably damaging Het
Fam171a2 T A 11: 102,437,881 D684V probably damaging Het
Fan1 A G 7: 64,363,199 V665A possibly damaging Het
Fbn2 A G 18: 58,037,747 C2191R probably damaging Het
Fkbp3 G A 12: 65,073,918 A2V probably benign Het
G6pd2 A G 5: 61,810,171 N430D probably benign Het
Gm13119 G A 4: 144,363,782 C464Y probably damaging Het
Gm13547 T A 2: 29,761,584 D7E possibly damaging Het
Hdac5 A T 11: 102,205,812 D260E probably damaging Het
Hist1h4i G T 13: 22,041,027 Y99* probably null Het
Hsf2bp T C 17: 32,013,346 E142G probably damaging Het
Igf1r C T 7: 68,165,155 T268I probably damaging Het
Kcne3 C T 7: 100,184,439 R88C probably damaging Het
Klk1b9 G T 7: 43,979,372 G100V possibly damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lama1 C T 17: 67,752,368 probably benign Het
Lcp2 C T 11: 34,082,426 P335S possibly damaging Het
Lrrk2 T A 15: 91,796,028 N2047K probably damaging Het
Mia2 T C 12: 59,136,143 L36P probably damaging Het
Mmp13 A T 9: 7,282,077 I460F possibly damaging Het
Mmp13 G A 9: 7,274,032 G169R probably damaging Het
Msh4 A G 3: 153,896,895 I232T probably damaging Het
Msra T A 14: 64,210,532 M145L probably benign Het
Myo7a A T 7: 98,112,150 probably benign Het
Nme8 A T 13: 19,658,036 N422K probably damaging Het
Nol6 A T 4: 41,121,115 F353I probably damaging Het
Nphp3 A G 9: 104,018,274 K384E probably damaging Het
Olfr572 C T 7: 102,928,604 probably null Het
Olfr652 A G 7: 104,564,337 I39V probably benign Het
Olfr672 A G 7: 104,996,703 I67T probably benign Het
Phox2b T G 5: 67,096,214 probably benign Het
Plec A T 15: 76,173,411 S4131T probably damaging Het
Pptc7 G A 5: 122,313,591 probably benign Het
Prpf40b A G 15: 99,316,289 E810G probably benign Het
Ptprc C T 1: 138,073,610 V965I probably benign Het
Pum1 T A 4: 130,728,104 M180K probably benign Het
Ranbp3 T C 17: 56,702,896 probably benign Het
Rasgrf2 A G 13: 91,972,274 S787P probably benign Het
Rnf19b T A 4: 129,073,551 N294K probably damaging Het
Samd3 A T 10: 26,244,495 H156L possibly damaging Het
Serpinb6c C T 13: 33,880,031 R347Q possibly damaging Het
Slc36a3 A G 11: 55,125,080 I416T probably damaging Het
Slc4a4 T A 5: 89,129,641 F279Y probably damaging Het
Slc6a2 T A 8: 92,992,801 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tab2 A G 10: 7,919,801 S232P probably benign Het
Tacc2 A T 7: 130,625,595 K1356* probably null Het
Tmem87a A G 2: 120,359,542 S544P probably damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Usp38 A T 8: 81,014,150 V96E probably benign Het
Vmn2r59 T C 7: 42,058,884 Y33C probably damaging Het
Vsig10l T G 7: 43,464,137 V171G probably damaging Het
Zfp957 T A 14: 79,212,920 I480F probably damaging Het
Other mutations in C8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:C8a APN 4 104865445 intron probably benign
IGL01326:C8a APN 4 104856420 missense probably damaging 1.00
IGL01339:C8a APN 4 104827985 missense probably benign 0.00
IGL01809:C8a APN 4 104845942 missense probably benign 0.06
IGL01843:C8a APN 4 104862611 nonsense probably null
IGL01988:C8a APN 4 104826694 missense probably damaging 1.00
IGL02187:C8a APN 4 104862736 missense probably damaging 1.00
IGL02430:C8a APN 4 104817522 missense probably damaging 0.97
IGL02537:C8a APN 4 104845951 missense probably damaging 1.00
derogation UTSW 4 104828078 missense possibly damaging 0.50
insult UTSW 4 104828039 missense probably benign 0.00
R0045:C8a UTSW 4 104826815 missense probably benign 0.00
R0045:C8a UTSW 4 104826815 missense probably benign 0.00
R0367:C8a UTSW 4 104862594 critical splice donor site probably null
R1013:C8a UTSW 4 104828039 missense probably benign 0.00
R1442:C8a UTSW 4 104828078 missense possibly damaging 0.50
R1902:C8a UTSW 4 104856601 critical splice acceptor site probably null
R2969:C8a UTSW 4 104853777 missense probably damaging 0.97
R3735:C8a UTSW 4 104817615 missense probably benign 0.43
R3736:C8a UTSW 4 104817615 missense probably benign 0.43
R4245:C8a UTSW 4 104876346 missense probably benign 0.00
R4707:C8a UTSW 4 104856421 missense probably damaging 1.00
R4812:C8a UTSW 4 104862591 splice site probably null
R5221:C8a UTSW 4 104845925 missense probably damaging 1.00
R5279:C8a UTSW 4 104845988 missense probably damaging 1.00
R5461:C8a UTSW 4 104815845 utr 3 prime probably benign
R5881:C8a UTSW 4 104853932 missense probably damaging 0.99
R6039:C8a UTSW 4 104845942 missense probably benign 0.00
R6039:C8a UTSW 4 104845942 missense probably benign 0.00
R6191:C8a UTSW 4 104845903 missense probably benign 0.00
R6626:C8a UTSW 4 104845967 missense probably benign 0.01
R7438:C8a UTSW 4 104861429 missense probably damaging 0.97
R7471:C8a UTSW 4 104817625 missense probably benign 0.01
R7514:C8a UTSW 4 104846050 missense possibly damaging 0.94
R7596:C8a UTSW 4 104853867 missense possibly damaging 0.49
R8947:C8a UTSW 4 104822129 missense probably damaging 1.00
R9039:C8a UTSW 4 104822003 missense probably benign
R9248:C8a UTSW 4 104846002 missense probably damaging 1.00
X0012:C8a UTSW 4 104826782 missense probably damaging 1.00
X0019:C8a UTSW 4 104817586 missense probably damaging 1.00
Z1176:C8a UTSW 4 104862686 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCAGTCACCTCAAACCCTATG -3'
(R):5'- CCAGATGCTCTGGCTAACAGCTAC -3'

Sequencing Primer
(F):5'- CCTATGGAAAATAAAAGCCTTCAGAG -3'
(R):5'- ggttctctacctgtaagtcctg -3'
Posted On 2013-07-11