Incidental Mutation 'R7747:Tert'
ID596934
Institutional Source Beutler Lab
Gene Symbol Tert
Ensembl Gene ENSMUSG00000021611
Gene Nametelomerase reverse transcriptase
SynonymsTR
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R7747 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73626911-73649843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73627606 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 159 (Y159H)
Ref Sequence ENSEMBL: ENSMUSP00000022104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022104] [ENSMUST00000221522] [ENSMUST00000223303]
Predicted Effect probably damaging
Transcript: ENSMUST00000022104
AA Change: Y159H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022104
Gene: ENSMUSG00000021611
AA Change: Y159H

DomainStartEndE-ValueType
Blast:Telomerase_RBD 329 375 2e-6 BLAST
Telomerase_RBD 449 584 5.02e-75 SMART
Blast:Telomerase_RBD 651 688 1e-5 BLAST
Pfam:RVT_1 787 918 6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221522
AA Change: Y159H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223303
AA Change: Y159H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of impaired telomerase function, homozygous mutant mice are overtly normal in early generations. Impaired fertility has been reported in later generations for homozygotes of at least one knockout allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik G A 5: 93,206,557 probably null Het
2410004P03Rik C T 12: 17,007,148 S116N probably damaging Het
3425401B19Rik T C 14: 32,663,069 D313G possibly damaging Het
AA986860 A G 1: 130,743,547 E502G possibly damaging Het
Adamts20 T A 15: 94,291,587 K1462* probably null Het
Adgrg6 A C 10: 14,450,577 probably null Het
Ankrd13d G A 19: 4,280,985 H165Y probably damaging Het
Arap3 T C 18: 37,988,888 probably null Het
Arhgap33 A G 7: 30,524,135 V823A probably damaging Het
Aup1 C A 6: 83,054,795 P34T unknown Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicc1 T C 10: 70,946,993 T515A probably benign Het
Ccdc73 A C 2: 104,929,556 K106Q probably damaging Het
Celsr3 G A 9: 108,829,978 R1220Q possibly damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cercam A G 2: 29,871,286 D104G probably benign Het
Champ1 A G 8: 13,879,990 H716R probably damaging Het
Cntrl A T 2: 35,116,798 I159F probably damaging Het
Col11a1 T C 3: 114,102,572 I507T unknown Het
Cped1 T C 6: 22,143,974 I573T probably damaging Het
Crot C T 5: 8,968,869 probably null Het
D1Pas1 T A 1: 186,968,677 S268T probably benign Het
Erich6 A G 3: 58,618,928 V551A probably damaging Het
Fbxo32 T C 15: 58,191,361 N192S probably damaging Het
Fgd6 T C 10: 94,044,916 V544A probably damaging Het
Fnbp1 C T 2: 31,036,147 G552E probably damaging Het
Gjb5 A T 4: 127,356,162 V63D probably damaging Het
Gm10053 T C 19: 24,876,039 I96T probably benign Het
Gm11639 T G 11: 104,842,603 I2011S probably damaging Het
Gm38119 T C 3: 92,738,021 S89G unknown Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gpn2 A G 4: 133,586,045 I183V probably benign Het
Greb1 C T 12: 16,674,795 V1793M probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Hrh2 T C 13: 54,214,530 V175A possibly damaging Het
Hsd3b3 C T 3: 98,743,898 V79I possibly damaging Het
Itgb7 T C 15: 102,216,604 I727M possibly damaging Het
Kcnj16 T A 11: 111,024,743 F77Y probably damaging Het
Lilra6 T A 7: 3,912,996 Q288L probably benign Het
Malrd1 G A 2: 16,074,835 V1788M unknown Het
Mau2 T C 8: 70,026,723 I349V possibly damaging Het
Mbnl3 C T X: 51,130,334 R181H probably damaging Het
Mfsd6 T C 1: 52,676,547 T524A probably benign Het
Mical2 G T 7: 112,333,839 R740L probably benign Het
Mknk1 G A 4: 115,878,072 C379Y possibly damaging Het
Mta3 A T 17: 83,791,736 K410* probably null Het
Myb A C 10: 21,156,425 I19S possibly damaging Het
Ncor2 A G 5: 125,027,038 F996S Het
Nlrp1a T C 11: 71,123,408 M339V possibly damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Olfr689 A G 7: 105,314,447 K148E probably damaging Het
Pcdhga5 C T 18: 37,696,782 T761I possibly damaging Het
Pcmtd2 T C 2: 181,851,659 L219P possibly damaging Het
Pfdn1 C T 18: 36,432,305 probably null Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Pld1 T C 3: 28,087,189 S634P possibly damaging Het
Pofut2 T G 10: 77,262,470 V139G possibly damaging Het
Prdm12 C A 2: 31,653,871 probably null Het
Prkar2b C A 12: 32,060,938 A49S probably benign Het
Prmt1 A T 7: 44,984,136 probably null Het
Rab39 A T 9: 53,686,400 D188E probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scgb1b19 A G 7: 33,287,498 I25V probably benign Het
Scn9a A T 2: 66,484,298 I1692N probably damaging Het
Sdk1 G T 5: 142,084,491 G1137V probably damaging Het
Sec16b A G 1: 157,565,472 T950A possibly damaging Het
Senp2 G T 16: 22,038,622 R398L probably damaging Het
Sfswap G T 5: 129,550,593 probably null Het
Sh3rf1 A G 8: 61,353,753 T362A probably damaging Het
Slc17a1 A T 13: 23,888,052 I418F probably benign Het
Slc1a4 A T 11: 20,308,587 M284K probably damaging Het
Slc5a2 A T 7: 128,266,395 probably null Het
Slco5a1 A G 1: 12,990,122 V125A probably benign Het
Smu1 A G 4: 40,748,600 V230A probably benign Het
Sp4 A G 12: 118,254,404 probably null Het
Stbd1 A G 5: 92,605,557 K302R probably damaging Het
Stx2 A T 5: 128,986,417 V268D probably benign Het
Tbc1d9b G A 11: 50,161,620 A885T probably benign Het
Tbce T A 13: 14,006,478 D267V possibly damaging Het
Thbs2 T A 17: 14,670,039 I1102F possibly damaging Het
Tmprss7 G C 16: 45,683,510 A183G probably benign Het
Top3b C A 16: 16,887,721 P450Q probably benign Het
Trpm6 A T 19: 18,750,045 probably null Het
Ube4a T C 9: 44,925,973 D988G probably damaging Het
Vmn1r158 A T 7: 22,790,300 S161R probably benign Het
Vps41 T C 13: 18,841,252 probably null Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp617 T A 8: 71,928,189 probably null Het
Zfp808 C T 13: 62,171,505 H183Y probably benign Het
Zfy1 A T Y: 725,496 C756* probably null Het
Zswim2 A T 2: 83,915,607 Y496N probably damaging Het
Other mutations in Tert
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Tert APN 13 73628297 missense possibly damaging 0.76
IGL01585:Tert APN 13 73634344 missense probably benign 0.15
IGL03167:Tert APN 13 73640000 missense probably damaging 1.00
galileo UTSW 13 73627606 missense probably damaging 1.00
FR4304:Tert UTSW 13 73648302 utr 3 prime probably benign
FR4342:Tert UTSW 13 73648300 utr 3 prime probably benign
FR4589:Tert UTSW 13 73648304 utr 3 prime probably benign
PIT4377001:Tert UTSW 13 73628261 missense possibly damaging 0.54
R0372:Tert UTSW 13 73648991 missense probably damaging 1.00
R0433:Tert UTSW 13 73627081 missense probably damaging 1.00
R0829:Tert UTSW 13 73644385 missense probably damaging 1.00
R1023:Tert UTSW 13 73642059 missense probably benign 0.41
R1236:Tert UTSW 13 73636379 missense probably damaging 0.99
R1331:Tert UTSW 13 73648354 missense probably damaging 1.00
R1426:Tert UTSW 13 73642353 splice site probably benign
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1521:Tert UTSW 13 73642056 missense probably damaging 1.00
R2484:Tert UTSW 13 73647985 missense probably benign
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R4428:Tert UTSW 13 73627475 missense probably damaging 1.00
R4430:Tert UTSW 13 73627475 missense probably damaging 1.00
R4431:Tert UTSW 13 73627475 missense probably damaging 1.00
R4630:Tert UTSW 13 73648991 missense probably damaging 1.00
R4696:Tert UTSW 13 73627820 missense probably benign 0.25
R4751:Tert UTSW 13 73628063 missense possibly damaging 0.89
R4926:Tert UTSW 13 73648389 missense possibly damaging 0.62
R5011:Tert UTSW 13 73646309 critical splice donor site probably null
R5013:Tert UTSW 13 73646309 critical splice donor site probably null
R5061:Tert UTSW 13 73634278 missense probably damaging 1.00
R5268:Tert UTSW 13 73627354 missense probably damaging 1.00
R5323:Tert UTSW 13 73648371 missense probably benign 0.07
R5396:Tert UTSW 13 73639243 missense probably damaging 0.97
R5445:Tert UTSW 13 73644284 missense probably benign 0.00
R5680:Tert UTSW 13 73642351 splice site probably null
R5688:Tert UTSW 13 73639156 missense probably damaging 1.00
R6092:Tert UTSW 13 73628581 missense probably benign 0.34
R6973:Tert UTSW 13 73627988 missense probably benign 0.02
R7069:Tert UTSW 13 73628410 missense probably damaging 0.99
R7317:Tert UTSW 13 73642376 missense probably damaging 1.00
R7787:Tert UTSW 13 73648932 missense probably damaging 0.99
R7846:Tert UTSW 13 73628195 missense probably damaging 1.00
R7994:Tert UTSW 13 73648955 missense probably benign 0.20
R8042:Tert UTSW 13 73627145 missense probably damaging 1.00
R8044:Tert UTSW 13 73635449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGAGCTGCTTAACGAGGC -3'
(R):5'- ATGCCTCTTTGTACCTCGAG -3'

Sequencing Primer
(F):5'- CTGCTTAACGAGGCCAGAG -3'
(R):5'- CTCTTTGTACCTCGAGATGGCAAG -3'
Posted On2019-11-26