Incidental Mutation 'R7747:Fbxo32'
ID 596937
Institutional Source Beutler Lab
Gene Symbol Fbxo32
Ensembl Gene ENSMUSG00000022358
Gene Name F-box protein 32
Synonyms 4833442G10Rik, atrogin-1, MAFbx, ATROGIN1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7747 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 58175879-58214932 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58191361 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 192 (N192S)
Ref Sequence ENSEMBL: ENSMUSP00000022986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022986]
AlphaFold Q9CPU7
Predicted Effect probably damaging
Transcript: ENSMUST00000022986
AA Change: N192S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022986
Gene: ENSMUSG00000022358
AA Change: N192S

DomainStartEndE-ValueType
Blast:FBOX 228 269 6e-16 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and contains an F-box domain. This protein is highly expressed during muscle atrophy, whereas mice deficient in this gene were found to be resistant to atrophy. This protein is thus a potential drug target for the treatment of muscle atrophy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
PHENOTYPE: A targeted homozygous mutation in this gene results in resistance to skeletal muscle atrophy in response to nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik G A 5: 93,206,557 probably null Het
2410004P03Rik C T 12: 17,007,148 S116N probably damaging Het
3425401B19Rik T C 14: 32,663,069 D313G possibly damaging Het
AA986860 A G 1: 130,743,547 E502G possibly damaging Het
Adamts20 T A 15: 94,291,587 K1462* probably null Het
Adgrg6 A C 10: 14,450,577 probably null Het
Ankrd13d G A 19: 4,280,985 H165Y probably damaging Het
Arap3 T C 18: 37,988,888 probably null Het
Arhgap33 A G 7: 30,524,135 V823A probably damaging Het
Aup1 C A 6: 83,054,795 P34T unknown Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicc1 T C 10: 70,946,993 T515A probably benign Het
Ccdc73 A C 2: 104,929,556 K106Q probably damaging Het
Celsr3 G A 9: 108,829,978 R1220Q possibly damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cercam A G 2: 29,871,286 D104G probably benign Het
Champ1 A G 8: 13,879,990 H716R probably damaging Het
Cntrl A T 2: 35,116,798 I159F probably damaging Het
Col11a1 T C 3: 114,102,572 I507T unknown Het
Cped1 T C 6: 22,143,974 I573T probably damaging Het
Crot C T 5: 8,968,869 probably null Het
D1Pas1 T A 1: 186,968,677 S268T probably benign Het
Erich6 A G 3: 58,618,928 V551A probably damaging Het
Fgd6 T C 10: 94,044,916 V544A probably damaging Het
Fnbp1 C T 2: 31,036,147 G552E probably damaging Het
Gjb5 A T 4: 127,356,162 V63D probably damaging Het
Gm10053 T C 19: 24,876,039 I96T probably benign Het
Gm11639 T G 11: 104,842,603 I2011S probably damaging Het
Gm38119 T C 3: 92,738,021 S89G unknown Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gpn2 A G 4: 133,586,045 I183V probably benign Het
Greb1 C T 12: 16,674,795 V1793M probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Hrh2 T C 13: 54,214,530 V175A possibly damaging Het
Hsd3b3 C T 3: 98,743,898 V79I possibly damaging Het
Itgb7 T C 15: 102,216,604 I727M possibly damaging Het
Kcnj16 T A 11: 111,024,743 F77Y probably damaging Het
Lilra6 T A 7: 3,912,996 Q288L probably benign Het
Malrd1 G A 2: 16,074,835 V1788M unknown Het
Mau2 T C 8: 70,026,723 I349V possibly damaging Het
Mbnl3 C T X: 51,130,334 R181H probably damaging Het
Mfsd6 T C 1: 52,676,547 T524A probably benign Het
Mical2 G T 7: 112,333,839 R740L probably benign Het
Mknk1 G A 4: 115,878,072 C379Y possibly damaging Het
Mta3 A T 17: 83,791,736 K410* probably null Het
Myb A C 10: 21,156,425 I19S possibly damaging Het
Ncor2 A G 5: 125,027,038 F996S Het
Nlrp1a T C 11: 71,123,408 M339V possibly damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Olfr689 A G 7: 105,314,447 K148E probably damaging Het
Pcdhga5 C T 18: 37,696,782 T761I possibly damaging Het
Pcmtd2 T C 2: 181,851,659 L219P possibly damaging Het
Pfdn1 C T 18: 36,432,305 probably null Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Pld1 T C 3: 28,087,189 S634P possibly damaging Het
Pofut2 T G 10: 77,262,470 V139G possibly damaging Het
Prdm12 C A 2: 31,653,871 probably null Het
Prkar2b C A 12: 32,060,938 A49S probably benign Het
Prmt1 A T 7: 44,984,136 probably null Het
Rab39 A T 9: 53,686,400 D188E probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scgb1b19 A G 7: 33,287,498 I25V probably benign Het
Scn9a A T 2: 66,484,298 I1692N probably damaging Het
Sdk1 G T 5: 142,084,491 G1137V probably damaging Het
Sec16b A G 1: 157,565,472 T950A possibly damaging Het
Senp2 G T 16: 22,038,622 R398L probably damaging Het
Sfswap G T 5: 129,550,593 probably null Het
Sh3rf1 A G 8: 61,353,753 T362A probably damaging Het
Slc17a1 A T 13: 23,888,052 I418F probably benign Het
Slc1a4 A T 11: 20,308,587 M284K probably damaging Het
Slc5a2 A T 7: 128,266,395 probably null Het
Slco5a1 A G 1: 12,990,122 V125A probably benign Het
Smu1 A G 4: 40,748,600 V230A probably benign Het
Sp4 A G 12: 118,254,404 probably null Het
Stbd1 A G 5: 92,605,557 K302R probably damaging Het
Stx2 A T 5: 128,986,417 V268D probably benign Het
Tbc1d9b G A 11: 50,161,620 A885T probably benign Het
Tbce T A 13: 14,006,478 D267V possibly damaging Het
Tert T C 13: 73,627,606 Y159H probably damaging Het
Thbs2 T A 17: 14,670,039 I1102F possibly damaging Het
Tmprss7 G C 16: 45,683,510 A183G probably benign Het
Top3b C A 16: 16,887,721 P450Q probably benign Het
Trpm6 A T 19: 18,750,045 probably null Het
Ube4a T C 9: 44,925,973 D988G probably damaging Het
Vmn1r158 A T 7: 22,790,300 S161R probably benign Het
Vps41 T C 13: 18,841,252 probably null Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp617 T A 8: 71,928,189 probably null Het
Zfp808 C T 13: 62,171,505 H183Y probably benign Het
Zfy1 A T Y: 725,496 C756* probably null Het
Zswim2 A T 2: 83,915,607 Y496N probably damaging Het
Other mutations in Fbxo32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Fbxo32 APN 15 58184236 missense probably damaging 0.98
IGL02371:Fbxo32 APN 15 58181464 utr 3 prime probably benign
IGL02721:Fbxo32 APN 15 58182962 missense possibly damaging 0.85
R0277:Fbxo32 UTSW 15 58184209 missense probably damaging 1.00
R0323:Fbxo32 UTSW 15 58184209 missense probably damaging 1.00
R1661:Fbxo32 UTSW 15 58191469 missense probably damaging 1.00
R2315:Fbxo32 UTSW 15 58208035 missense probably benign 0.28
R2321:Fbxo32 UTSW 15 58191293 missense possibly damaging 0.52
R2849:Fbxo32 UTSW 15 58207972 missense probably benign
R4233:Fbxo32 UTSW 15 58192333 missense possibly damaging 0.81
R4569:Fbxo32 UTSW 15 58181477 missense probably damaging 0.99
R6856:Fbxo32 UTSW 15 58214641 start gained probably benign
R7868:Fbxo32 UTSW 15 58214590 missense probably damaging 1.00
R8317:Fbxo32 UTSW 15 58205230 missense probably damaging 1.00
R9009:Fbxo32 UTSW 15 58182962 missense possibly damaging 0.85
Z1176:Fbxo32 UTSW 15 58205242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGATGAGGCATCAAATCAG -3'
(R):5'- CACTTGTAACATGCCTGGCTTC -3'

Sequencing Primer
(F):5'- CACCAGAGTAGACTATGTTGCCTTG -3'
(R):5'- GTAACATGCCTGGCTTCAATAAC -3'
Posted On 2019-11-26