Incidental Mutation 'R7747:Tmprss7'
ID596942
Institutional Source Beutler Lab
Gene Symbol Tmprss7
Ensembl Gene ENSMUSG00000033177
Gene Nametransmembrane serine protease 7
Synonymsmatriptase-3, B230219I23Rik, LOC385645
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7747 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location45656315-45693658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 45683510 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 183 (A183G)
Ref Sequence ENSEMBL: ENSMUSP00000110209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114562]
Predicted Effect probably benign
Transcript: ENSMUST00000114562
AA Change: A183G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110209
Gene: ENSMUSG00000033177
AA Change: A183G

DomainStartEndE-ValueType
low complexity region 28 55 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
Pfam:SEA 94 198 4.6e-23 PFAM
CUB 233 346 9.35e-4 SMART
Pfam:CUB 351 454 3e-7 PFAM
LDLa 469 506 5.63e-13 SMART
LDLa 510 541 5.56e-2 SMART
LDLa 544 582 8.95e-7 SMART
Tryp_SPc 591 821 7.17e-85 SMART
Meta Mutation Damage Score 0.1975 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik G A 5: 93,206,557 probably null Het
2410004P03Rik C T 12: 17,007,148 S116N probably damaging Het
3425401B19Rik T C 14: 32,663,069 D313G possibly damaging Het
AA986860 A G 1: 130,743,547 E502G possibly damaging Het
Adamts20 T A 15: 94,291,587 K1462* probably null Het
Adgrg6 A C 10: 14,450,577 probably null Het
Ankrd13d G A 19: 4,280,985 H165Y probably damaging Het
Arap3 T C 18: 37,988,888 probably null Het
Arhgap33 A G 7: 30,524,135 V823A probably damaging Het
Aup1 C A 6: 83,054,795 P34T unknown Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicc1 T C 10: 70,946,993 T515A probably benign Het
Ccdc73 A C 2: 104,929,556 K106Q probably damaging Het
Celsr3 G A 9: 108,829,978 R1220Q possibly damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cercam A G 2: 29,871,286 D104G probably benign Het
Champ1 A G 8: 13,879,990 H716R probably damaging Het
Cntrl A T 2: 35,116,798 I159F probably damaging Het
Col11a1 T C 3: 114,102,572 I507T unknown Het
Cped1 T C 6: 22,143,974 I573T probably damaging Het
Crot C T 5: 8,968,869 probably null Het
D1Pas1 T A 1: 186,968,677 S268T probably benign Het
Erich6 A G 3: 58,618,928 V551A probably damaging Het
Fbxo32 T C 15: 58,191,361 N192S probably damaging Het
Fgd6 T C 10: 94,044,916 V544A probably damaging Het
Fnbp1 C T 2: 31,036,147 G552E probably damaging Het
Gjb5 A T 4: 127,356,162 V63D probably damaging Het
Gm10053 T C 19: 24,876,039 I96T probably benign Het
Gm11639 T G 11: 104,842,603 I2011S probably damaging Het
Gm38119 T C 3: 92,738,021 S89G unknown Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gpn2 A G 4: 133,586,045 I183V probably benign Het
Greb1 C T 12: 16,674,795 V1793M probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Hrh2 T C 13: 54,214,530 V175A possibly damaging Het
Hsd3b3 C T 3: 98,743,898 V79I possibly damaging Het
Itgb7 T C 15: 102,216,604 I727M possibly damaging Het
Kcnj16 T A 11: 111,024,743 F77Y probably damaging Het
Lilra6 T A 7: 3,912,996 Q288L probably benign Het
Malrd1 G A 2: 16,074,835 V1788M unknown Het
Mau2 T C 8: 70,026,723 I349V possibly damaging Het
Mbnl3 C T X: 51,130,334 R181H probably damaging Het
Mfsd6 T C 1: 52,676,547 T524A probably benign Het
Mical2 G T 7: 112,333,839 R740L probably benign Het
Mknk1 G A 4: 115,878,072 C379Y possibly damaging Het
Mta3 A T 17: 83,791,736 K410* probably null Het
Myb A C 10: 21,156,425 I19S possibly damaging Het
Ncor2 A G 5: 125,027,038 F996S Het
Nlrp1a T C 11: 71,123,408 M339V possibly damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Olfr689 A G 7: 105,314,447 K148E probably damaging Het
Pcdhga5 C T 18: 37,696,782 T761I possibly damaging Het
Pcmtd2 T C 2: 181,851,659 L219P possibly damaging Het
Pfdn1 C T 18: 36,432,305 probably null Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Pld1 T C 3: 28,087,189 S634P possibly damaging Het
Pofut2 T G 10: 77,262,470 V139G possibly damaging Het
Prdm12 C A 2: 31,653,871 probably null Het
Prkar2b C A 12: 32,060,938 A49S probably benign Het
Prmt1 A T 7: 44,984,136 probably null Het
Rab39 A T 9: 53,686,400 D188E probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scgb1b19 A G 7: 33,287,498 I25V probably benign Het
Scn9a A T 2: 66,484,298 I1692N probably damaging Het
Sdk1 G T 5: 142,084,491 G1137V probably damaging Het
Sec16b A G 1: 157,565,472 T950A possibly damaging Het
Senp2 G T 16: 22,038,622 R398L probably damaging Het
Sfswap G T 5: 129,550,593 probably null Het
Sh3rf1 A G 8: 61,353,753 T362A probably damaging Het
Slc17a1 A T 13: 23,888,052 I418F probably benign Het
Slc1a4 A T 11: 20,308,587 M284K probably damaging Het
Slc5a2 A T 7: 128,266,395 probably null Het
Slco5a1 A G 1: 12,990,122 V125A probably benign Het
Smu1 A G 4: 40,748,600 V230A probably benign Het
Sp4 A G 12: 118,254,404 probably null Het
Stbd1 A G 5: 92,605,557 K302R probably damaging Het
Stx2 A T 5: 128,986,417 V268D probably benign Het
Tbc1d9b G A 11: 50,161,620 A885T probably benign Het
Tbce T A 13: 14,006,478 D267V possibly damaging Het
Tert T C 13: 73,627,606 Y159H probably damaging Het
Thbs2 T A 17: 14,670,039 I1102F possibly damaging Het
Top3b C A 16: 16,887,721 P450Q probably benign Het
Trpm6 A T 19: 18,750,045 probably null Het
Ube4a T C 9: 44,925,973 D988G probably damaging Het
Vmn1r158 A T 7: 22,790,300 S161R probably benign Het
Vps41 T C 13: 18,841,252 probably null Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp617 T A 8: 71,928,189 probably null Het
Zfp808 C T 13: 62,171,505 H183Y probably benign Het
Zfy1 A T Y: 725,496 C756* probably null Het
Zswim2 A T 2: 83,915,607 Y496N probably damaging Het
Other mutations in Tmprss7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tmprss7 APN 16 45663368 missense probably benign
IGL00985:Tmprss7 APN 16 45662322 missense probably damaging 1.00
IGL01115:Tmprss7 APN 16 45660789 missense probably damaging 1.00
IGL01296:Tmprss7 APN 16 45684574 missense probably damaging 0.98
IGL01298:Tmprss7 APN 16 45664175 missense probably benign 0.00
IGL01459:Tmprss7 APN 16 45663343 missense probably benign 0.00
IGL01785:Tmprss7 APN 16 45680634 missense probably damaging 1.00
IGL02313:Tmprss7 APN 16 45681593 missense probably damaging 1.00
IGL02893:Tmprss7 APN 16 45669528 missense possibly damaging 0.65
IGL02940:Tmprss7 APN 16 45656455 missense probably damaging 1.00
IGL03291:Tmprss7 APN 16 45680748 missense probably benign
amalgum UTSW 16 45683510 missense probably benign 0.15
fusion UTSW 16 45690760 missense probably damaging 1.00
steely UTSW 16 45667606 nonsense probably null
P0019:Tmprss7 UTSW 16 45680733 missense probably benign
R0051:Tmprss7 UTSW 16 45673939 missense probably damaging 1.00
R0051:Tmprss7 UTSW 16 45673939 missense probably damaging 1.00
R0092:Tmprss7 UTSW 16 45667596 missense probably damaging 1.00
R0178:Tmprss7 UTSW 16 45690843 missense probably damaging 1.00
R0219:Tmprss7 UTSW 16 45656457 missense probably damaging 1.00
R0332:Tmprss7 UTSW 16 45680638 missense probably benign 0.01
R0607:Tmprss7 UTSW 16 45669551 missense probably damaging 0.97
R0669:Tmprss7 UTSW 16 45677962 nonsense probably null
R0783:Tmprss7 UTSW 16 45667606 nonsense probably null
R1447:Tmprss7 UTSW 16 45680670 missense probably benign
R1538:Tmprss7 UTSW 16 45679390 missense probably benign 0.44
R1564:Tmprss7 UTSW 16 45662153 critical splice donor site probably null
R1912:Tmprss7 UTSW 16 45656548 nonsense probably null
R1932:Tmprss7 UTSW 16 45684593 nonsense probably null
R2257:Tmprss7 UTSW 16 45686333 missense possibly damaging 0.47
R3840:Tmprss7 UTSW 16 45660832 nonsense probably null
R4232:Tmprss7 UTSW 16 45656573 missense probably damaging 1.00
R4332:Tmprss7 UTSW 16 45686327 missense probably benign 0.00
R4685:Tmprss7 UTSW 16 45679348 missense probably benign
R4712:Tmprss7 UTSW 16 45690760 missense probably damaging 1.00
R4822:Tmprss7 UTSW 16 45663316 missense probably damaging 1.00
R5368:Tmprss7 UTSW 16 45660889 missense probably damaging 1.00
R5386:Tmprss7 UTSW 16 45669528 missense possibly damaging 0.65
R5468:Tmprss7 UTSW 16 45656448 missense probably damaging 1.00
R5526:Tmprss7 UTSW 16 45660904 missense probably damaging 1.00
R5719:Tmprss7 UTSW 16 45686430 missense probably damaging 0.99
R6149:Tmprss7 UTSW 16 45673905 nonsense probably null
R6235:Tmprss7 UTSW 16 45658122 missense probably benign 0.03
R6358:Tmprss7 UTSW 16 45669573 missense probably benign 0.00
R6645:Tmprss7 UTSW 16 45690963 missense possibly damaging 0.90
R7187:Tmprss7 UTSW 16 45677954 missense possibly damaging 0.50
R7222:Tmprss7 UTSW 16 45690893 missense probably benign
R7634:Tmprss7 UTSW 16 45663274 missense probably benign 0.00
R7776:Tmprss7 UTSW 16 45667651 missense probably benign 0.03
R7777:Tmprss7 UTSW 16 45660600 splice site probably null
R8222:Tmprss7 UTSW 16 45658098 missense probably damaging 0.99
T0975:Tmprss7 UTSW 16 45680733 missense probably benign
Z1176:Tmprss7 UTSW 16 45662256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCTCTACTCCTGGGATCG -3'
(R):5'- GCTCAGTGACCTTGAATCTGTC -3'

Sequencing Primer
(F):5'- CGTGAGAGTCTCTACTACGATG -3'
(R):5'- AGTGACCTTGAATCTGTCAGTTTC -3'
Posted On2019-11-26