Incidental Mutation 'R7747:Thbs2'
ID596943
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Namethrombospondin 2
SynonymsThbs-2, Thrombospondin-2, TSP2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R7747 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location14665500-14694235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14670039 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1102 (I1102F)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170872
AA Change: I1102F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: I1102F

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik G A 5: 93,206,557 probably null Het
2410004P03Rik C T 12: 17,007,148 S116N probably damaging Het
3425401B19Rik T C 14: 32,663,069 D313G possibly damaging Het
AA986860 A G 1: 130,743,547 E502G possibly damaging Het
Adamts20 T A 15: 94,291,587 K1462* probably null Het
Adgrg6 A C 10: 14,450,577 probably null Het
Ankrd13d G A 19: 4,280,985 H165Y probably damaging Het
Arap3 T C 18: 37,988,888 probably null Het
Arhgap33 A G 7: 30,524,135 V823A probably damaging Het
Aup1 C A 6: 83,054,795 P34T unknown Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicc1 T C 10: 70,946,993 T515A probably benign Het
Ccdc73 A C 2: 104,929,556 K106Q probably damaging Het
Celsr3 G A 9: 108,829,978 R1220Q possibly damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cercam A G 2: 29,871,286 D104G probably benign Het
Champ1 A G 8: 13,879,990 H716R probably damaging Het
Cntrl A T 2: 35,116,798 I159F probably damaging Het
Col11a1 T C 3: 114,102,572 I507T unknown Het
Cped1 T C 6: 22,143,974 I573T probably damaging Het
Crot C T 5: 8,968,869 probably null Het
D1Pas1 T A 1: 186,968,677 S268T probably benign Het
Erich6 A G 3: 58,618,928 V551A probably damaging Het
Fbxo32 T C 15: 58,191,361 N192S probably damaging Het
Fgd6 T C 10: 94,044,916 V544A probably damaging Het
Fnbp1 C T 2: 31,036,147 G552E probably damaging Het
Gjb5 A T 4: 127,356,162 V63D probably damaging Het
Gm10053 T C 19: 24,876,039 I96T probably benign Het
Gm11639 T G 11: 104,842,603 I2011S probably damaging Het
Gm38119 T C 3: 92,738,021 S89G unknown Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gpn2 A G 4: 133,586,045 I183V probably benign Het
Greb1 C T 12: 16,674,795 V1793M probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Hrh2 T C 13: 54,214,530 V175A possibly damaging Het
Hsd3b3 C T 3: 98,743,898 V79I possibly damaging Het
Itgb7 T C 15: 102,216,604 I727M possibly damaging Het
Kcnj16 T A 11: 111,024,743 F77Y probably damaging Het
Lilra6 T A 7: 3,912,996 Q288L probably benign Het
Malrd1 G A 2: 16,074,835 V1788M unknown Het
Mau2 T C 8: 70,026,723 I349V possibly damaging Het
Mbnl3 C T X: 51,130,334 R181H probably damaging Het
Mfsd6 T C 1: 52,676,547 T524A probably benign Het
Mical2 G T 7: 112,333,839 R740L probably benign Het
Mknk1 G A 4: 115,878,072 C379Y possibly damaging Het
Mta3 A T 17: 83,791,736 K410* probably null Het
Myb A C 10: 21,156,425 I19S possibly damaging Het
Ncor2 A G 5: 125,027,038 F996S Het
Nlrp1a T C 11: 71,123,408 M339V possibly damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Olfr689 A G 7: 105,314,447 K148E probably damaging Het
Pcdhga5 C T 18: 37,696,782 T761I possibly damaging Het
Pcmtd2 T C 2: 181,851,659 L219P possibly damaging Het
Pfdn1 C T 18: 36,432,305 probably null Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Pld1 T C 3: 28,087,189 S634P possibly damaging Het
Pofut2 T G 10: 77,262,470 V139G possibly damaging Het
Prdm12 C A 2: 31,653,871 probably null Het
Prkar2b C A 12: 32,060,938 A49S probably benign Het
Prmt1 A T 7: 44,984,136 probably null Het
Rab39 A T 9: 53,686,400 D188E probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scgb1b19 A G 7: 33,287,498 I25V probably benign Het
Scn9a A T 2: 66,484,298 I1692N probably damaging Het
Sdk1 G T 5: 142,084,491 G1137V probably damaging Het
Sec16b A G 1: 157,565,472 T950A possibly damaging Het
Senp2 G T 16: 22,038,622 R398L probably damaging Het
Sfswap G T 5: 129,550,593 probably null Het
Sh3rf1 A G 8: 61,353,753 T362A probably damaging Het
Slc17a1 A T 13: 23,888,052 I418F probably benign Het
Slc1a4 A T 11: 20,308,587 M284K probably damaging Het
Slc5a2 A T 7: 128,266,395 probably null Het
Slco5a1 A G 1: 12,990,122 V125A probably benign Het
Smu1 A G 4: 40,748,600 V230A probably benign Het
Sp4 A G 12: 118,254,404 probably null Het
Stbd1 A G 5: 92,605,557 K302R probably damaging Het
Stx2 A T 5: 128,986,417 V268D probably benign Het
Tbc1d9b G A 11: 50,161,620 A885T probably benign Het
Tbce T A 13: 14,006,478 D267V possibly damaging Het
Tert T C 13: 73,627,606 Y159H probably damaging Het
Tmprss7 G C 16: 45,683,510 A183G probably benign Het
Top3b C A 16: 16,887,721 P450Q probably benign Het
Trpm6 A T 19: 18,750,045 probably null Het
Ube4a T C 9: 44,925,973 D988G probably damaging Het
Vmn1r158 A T 7: 22,790,300 S161R probably benign Het
Vps41 T C 13: 18,841,252 probably null Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp617 T A 8: 71,928,189 probably null Het
Zfp808 C T 13: 62,171,505 H183Y probably benign Het
Zfy1 A T Y: 725,496 C756* probably null Het
Zswim2 A T 2: 83,915,607 Y496N probably damaging Het
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14668835 missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14690252 missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14690065 missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14678769 missense probably benign 0.31
IGL01936:Thbs2 APN 17 14687814 missense probably benign 0.00
IGL02061:Thbs2 APN 17 14679914 missense probably benign 0.35
IGL02255:Thbs2 APN 17 14689785 missense probably benign 0.00
IGL02342:Thbs2 APN 17 14676316 missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14671454 missense probably benign 0.01
IGL02499:Thbs2 APN 17 14684066 splice site probably benign
IGL02572:Thbs2 APN 17 14677013 missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14683361 missense probably benign 0.05
IGL02871:Thbs2 APN 17 14685786 missense probably benign
IGL03058:Thbs2 APN 17 14689969 missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14681410 nonsense probably null
IGL03232:Thbs2 APN 17 14691413 start codon destroyed probably null
IGL03289:Thbs2 APN 17 14690122 missense probably benign 0.00
IGL03407:Thbs2 APN 17 14673273 missense probably benign 0.00
H8562:Thbs2 UTSW 17 14671453 missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14684127 missense probably benign 0.01
PIT4354001:Thbs2 UTSW 17 14689968 missense probably damaging 0.99
R0088:Thbs2 UTSW 17 14681701 missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14667525 splice site probably benign
R0415:Thbs2 UTSW 17 14679973 missense probably benign
R0658:Thbs2 UTSW 17 14680325 missense probably benign 0.00
R0735:Thbs2 UTSW 17 14679815 missense probably benign 0.00
R1582:Thbs2 UTSW 17 14671288 missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14689768 missense probably benign 0.00
R1608:Thbs2 UTSW 17 14685781 missense probably benign
R1721:Thbs2 UTSW 17 14678810 missense probably benign 0.00
R1724:Thbs2 UTSW 17 14685900 missense possibly damaging 0.80
R1791:Thbs2 UTSW 17 14685813 missense probably benign
R1816:Thbs2 UTSW 17 14670713 missense probably benign 0.01
R1816:Thbs2 UTSW 17 14670714 missense probably benign 0.00
R1911:Thbs2 UTSW 17 14689842 missense probably benign 0.38
R2137:Thbs2 UTSW 17 14673306 missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14673209 missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14690289 splice site probably null
R2509:Thbs2 UTSW 17 14685843 missense probably benign 0.11
R3838:Thbs2 UTSW 17 14687851 missense probably benign
R4173:Thbs2 UTSW 17 14681631 intron probably null
R4427:Thbs2 UTSW 17 14680335 missense probably benign
R4495:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R4789:Thbs2 UTSW 17 14671488 missense probably damaging 1.00
R4928:Thbs2 UTSW 17 14678900 missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14676329 missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14670590 splice site probably null
R5619:Thbs2 UTSW 17 14681244 missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14689953 missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14689837 missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14687863 missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14684071 critical splice donor site probably null
R5840:Thbs2 UTSW 17 14681430 splice site probably null
R6149:Thbs2 UTSW 17 14679680 critical splice donor site probably null
R6166:Thbs2 UTSW 17 14680388 missense probably damaging 1.00
R6412:Thbs2 UTSW 17 14677077 missense probably damaging 1.00
R6473:Thbs2 UTSW 17 14685796 missense probably benign 0.23
R6640:Thbs2 UTSW 17 14673368 missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14674164 missense possibly damaging 0.54
R6711:Thbs2 UTSW 17 14690265 missense probably benign 0.00
R6947:Thbs2 UTSW 17 14689767 missense possibly damaging 0.79
R6962:Thbs2 UTSW 17 14681820 missense probably benign 0.00
R7183:Thbs2 UTSW 17 14690116 missense possibly damaging 0.90
R7203:Thbs2 UTSW 17 14671458 missense probably damaging 1.00
R7386:Thbs2 UTSW 17 14673150 missense possibly damaging 0.95
R7621:Thbs2 UTSW 17 14674164 missense probably benign
R7759:Thbs2 UTSW 17 14677059 missense probably damaging 1.00
R7800:Thbs2 UTSW 17 14676296 missense probably damaging 1.00
R7895:Thbs2 UTSW 17 14676221 missense probably damaging 1.00
R7978:Thbs2 UTSW 17 14676221 missense probably damaging 1.00
S24628:Thbs2 UTSW 17 14679973 missense probably benign
X0025:Thbs2 UTSW 17 14681800 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGTAACAGGCTATCCATCC -3'
(R):5'- AGTAGGGTAGATGATACAGCATTTG -3'

Sequencing Primer
(F):5'- GGGTAACAGGCTATCCATCCATTTG -3'
(R):5'- TACTAGGGAGGTAGTACAGC -3'
Posted On2019-11-26