Incidental Mutation 'R7747:Zfy1'
ID 596952
Institutional Source Beutler Lab
Gene Symbol Zfy1
Ensembl Gene ENSMUSG00000053211
Gene Name zinc finger protein 1, Y-linked
Synonyms Zfy-1
MMRRC Submission 045803-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.047) question?
Stock # R7747 (G1)
Quality Score 221.999
Status Validated
Chromosome Y
Chromosomal Location 725207-797409 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 725496 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 756 (C756*)
Ref Sequence ENSEMBL: ENSMUSP00000069364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065545] [ENSMUST00000189888]
AlphaFold P10925
Predicted Effect probably null
Transcript: ENSMUST00000065545
AA Change: C756*
SMART Domains Protein: ENSMUSP00000069364
Gene: ENSMUSG00000053211
AA Change: C756*

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 68 388 1.1e-109 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189888
AA Change: C756*
SMART Domains Protein: ENSMUSP00000140600
Gene: ENSMUSG00000053211
AA Change: C756*

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 67 388 1.2e-141 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik G A 5: 93,354,416 (GRCm39) probably null Het
2410004P03Rik C T 12: 17,057,149 (GRCm39) S116N probably damaging Het
3425401B19Rik T C 14: 32,385,026 (GRCm39) D313G possibly damaging Het
AA986860 A G 1: 130,671,284 (GRCm39) E502G possibly damaging Het
Adamts20 T A 15: 94,189,468 (GRCm39) K1462* probably null Het
Adgrg6 A C 10: 14,326,321 (GRCm39) probably null Het
Ankrd13d G A 19: 4,331,013 (GRCm39) H165Y probably damaging Het
Arap3 T C 18: 38,121,941 (GRCm39) probably null Het
Arhgap33 A G 7: 30,223,560 (GRCm39) V823A probably damaging Het
Aup1 C A 6: 83,031,776 (GRCm39) P34T unknown Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bicc1 T C 10: 70,782,823 (GRCm39) T515A probably benign Het
Ccdc73 A C 2: 104,759,901 (GRCm39) K106Q probably damaging Het
Celsr3 G A 9: 108,707,177 (GRCm39) R1220Q possibly damaging Het
Cep290 C T 10: 100,394,038 (GRCm39) Q2082* probably null Het
Cercam A G 2: 29,761,298 (GRCm39) D104G probably benign Het
Champ1 A G 8: 13,929,990 (GRCm39) H716R probably damaging Het
Cntrl A T 2: 35,006,810 (GRCm39) I159F probably damaging Het
Col11a1 T C 3: 113,896,221 (GRCm39) I507T unknown Het
Cped1 T C 6: 22,143,973 (GRCm39) I573T probably damaging Het
Crot C T 5: 9,018,869 (GRCm39) probably null Het
D1Pas1 T A 1: 186,700,874 (GRCm39) S268T probably benign Het
Efcab3 T G 11: 104,733,429 (GRCm39) I2011S probably damaging Het
Erich6 A G 3: 58,526,349 (GRCm39) V551A probably damaging Het
Fbxo32 T C 15: 58,054,757 (GRCm39) N192S probably damaging Het
Fgd6 T C 10: 93,880,778 (GRCm39) V544A probably damaging Het
Fnbp1 C T 2: 30,926,159 (GRCm39) G552E probably damaging Het
Gjb5 A T 4: 127,249,955 (GRCm39) V63D probably damaging Het
Gm10053 T C 19: 24,853,403 (GRCm39) I96T probably benign Het
Gm38119 T C 3: 92,645,328 (GRCm39) S89G unknown Het
Gpn2 A G 4: 133,313,356 (GRCm39) I183V probably benign Het
Greb1 C T 12: 16,724,796 (GRCm39) V1793M probably benign Het
H2-Q7 A G 17: 35,659,037 (GRCm39) I163V probably benign Het
Hrh2 T C 13: 54,368,549 (GRCm39) V175A possibly damaging Het
Hsd3b3 C T 3: 98,651,214 (GRCm39) V79I possibly damaging Het
Itgb7 T C 15: 102,125,039 (GRCm39) I727M possibly damaging Het
Kcnj16 T A 11: 110,915,569 (GRCm39) F77Y probably damaging Het
Lilra6 T A 7: 3,915,995 (GRCm39) Q288L probably benign Het
Lrrc37 A T 11: 103,505,081 (GRCm39) S2296T probably damaging Het
Malrd1 G A 2: 16,079,646 (GRCm39) V1788M unknown Het
Mau2 T C 8: 70,479,373 (GRCm39) I349V possibly damaging Het
Mbnl3 C T X: 50,219,211 (GRCm39) R181H probably damaging Het
Mfsd6 T C 1: 52,715,706 (GRCm39) T524A probably benign Het
Mical2 G T 7: 111,933,046 (GRCm39) R740L probably benign Het
Mknk1 G A 4: 115,735,269 (GRCm39) C379Y possibly damaging Het
Mta3 A T 17: 84,099,165 (GRCm39) K410* probably null Het
Myb A C 10: 21,032,324 (GRCm39) I19S possibly damaging Het
Ncor2 A G 5: 125,104,102 (GRCm39) F996S Het
Nlrp1a T C 11: 71,014,234 (GRCm39) M339V possibly damaging Het
Or2n1d C T 17: 38,646,285 (GRCm39) P79L probably benign Het
Or56b35 A G 7: 104,963,654 (GRCm39) K148E probably damaging Het
Pcdhga5 C T 18: 37,829,835 (GRCm39) T761I possibly damaging Het
Pcmtd2 T C 2: 181,493,452 (GRCm39) L219P possibly damaging Het
Pfdn1 C T 18: 36,565,358 (GRCm39) probably null Het
Pkn3 G A 2: 29,980,596 (GRCm39) C829Y probably benign Het
Pld1 T C 3: 28,141,338 (GRCm39) S634P possibly damaging Het
Pofut2 T G 10: 77,098,304 (GRCm39) V139G possibly damaging Het
Prdm12 C A 2: 31,543,883 (GRCm39) probably null Het
Prkar2b C A 12: 32,110,937 (GRCm39) A49S probably benign Het
Prmt1 A T 7: 44,633,560 (GRCm39) probably null Het
Rab39 A T 9: 53,597,700 (GRCm39) D188E probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Scgb1b19 A G 7: 32,986,923 (GRCm39) I25V probably benign Het
Scn9a A T 2: 66,314,642 (GRCm39) I1692N probably damaging Het
Sdk1 G T 5: 142,070,246 (GRCm39) G1137V probably damaging Het
Sec16b A G 1: 157,393,042 (GRCm39) T950A possibly damaging Het
Senp2 G T 16: 21,857,372 (GRCm39) R398L probably damaging Het
Sfswap G T 5: 129,627,657 (GRCm39) probably null Het
Sh3rf1 A G 8: 61,806,787 (GRCm39) T362A probably damaging Het
Slc17a1 A T 13: 24,072,035 (GRCm39) I418F probably benign Het
Slc1a4 A T 11: 20,258,587 (GRCm39) M284K probably damaging Het
Slc5a2 A T 7: 127,865,567 (GRCm39) probably null Het
Slco5a1 A G 1: 13,060,346 (GRCm39) V125A probably benign Het
Smu1 A G 4: 40,748,600 (GRCm39) V230A probably benign Het
Sp4 A G 12: 118,218,139 (GRCm39) probably null Het
Stbd1 A G 5: 92,753,416 (GRCm39) K302R probably damaging Het
Stx2 A T 5: 129,063,481 (GRCm39) V268D probably benign Het
Tbc1d9b G A 11: 50,052,447 (GRCm39) A885T probably benign Het
Tbce T A 13: 14,181,063 (GRCm39) D267V possibly damaging Het
Tert T C 13: 73,775,725 (GRCm39) Y159H probably damaging Het
Thbs2 T A 17: 14,890,301 (GRCm39) I1102F possibly damaging Het
Tmprss7 G C 16: 45,503,873 (GRCm39) A183G probably benign Het
Top3b C A 16: 16,705,585 (GRCm39) P450Q probably benign Het
Trpm6 A T 19: 18,727,409 (GRCm39) probably null Het
Ube4a T C 9: 44,837,271 (GRCm39) D988G probably damaging Het
Vmn1r158 A T 7: 22,489,725 (GRCm39) S161R probably benign Het
Vps41 T C 13: 19,025,422 (GRCm39) probably null Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp617 T A 8: 72,682,033 (GRCm39) probably null Het
Zfp808 C T 13: 62,319,319 (GRCm39) H183Y probably benign Het
Zswim2 A T 2: 83,745,951 (GRCm39) Y496N probably damaging Het
Other mutations in Zfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0149:Zfy1 UTSW Y 726,121 (GRCm39) missense possibly damaging 0.95
R0361:Zfy1 UTSW Y 726,121 (GRCm39) missense possibly damaging 0.95
R0529:Zfy1 UTSW Y 726,040 (GRCm39) missense probably damaging 1.00
R0837:Zfy1 UTSW Y 725,850 (GRCm39) nonsense probably null
R0945:Zfy1 UTSW Y 725,983 (GRCm39) missense probably damaging 0.98
R1163:Zfy1 UTSW Y 725,611 (GRCm39) missense probably damaging 0.98
R1394:Zfy1 UTSW Y 725,957 (GRCm39) missense possibly damaging 0.79
R1806:Zfy1 UTSW Y 725,620 (GRCm39) missense possibly damaging 0.88
R1928:Zfy1 UTSW Y 729,733 (GRCm39) missense unknown
R2374:Zfy1 UTSW Y 726,392 (GRCm39) missense possibly damaging 0.77
R2374:Zfy1 UTSW Y 726,391 (GRCm39) missense probably damaging 0.99
R2889:Zfy1 UTSW Y 726,307 (GRCm39) missense possibly damaging 0.95
R2980:Zfy1 UTSW Y 739,054 (GRCm39) missense unknown
R3437:Zfy1 UTSW Y 726,357 (GRCm39) missense possibly damaging 0.82
R4454:Zfy1 UTSW Y 725,518 (GRCm39) missense possibly damaging 0.86
R4529:Zfy1 UTSW Y 726,511 (GRCm39) missense possibly damaging 0.93
R4656:Zfy1 UTSW Y 729,626 (GRCm39) missense unknown
R5049:Zfy1 UTSW Y 726,004 (GRCm39) missense possibly damaging 0.93
R5087:Zfy1 UTSW Y 732,964 (GRCm39) missense unknown
R5347:Zfy1 UTSW Y 725,950 (GRCm39) missense possibly damaging 0.90
R5428:Zfy1 UTSW Y 726,205 (GRCm39) missense possibly damaging 0.95
R5825:Zfy1 UTSW Y 726,531 (GRCm39) missense possibly damaging 0.85
R6256:Zfy1 UTSW Y 738,765 (GRCm39) missense unknown
R7065:Zfy1 UTSW Y 725,428 (GRCm39) missense probably benign 0.33
R7134:Zfy1 UTSW Y 725,788 (GRCm39) missense probably damaging 0.99
R7185:Zfy1 UTSW Y 725,464 (GRCm39) missense possibly damaging 0.53
R7358:Zfy1 UTSW Y 735,141 (GRCm39) missense unknown
R7513:Zfy1 UTSW Y 759,852 (GRCm39) missense unknown
R7900:Zfy1 UTSW Y 725,519 (GRCm39) missense possibly damaging 0.53
R8052:Zfy1 UTSW Y 726,004 (GRCm39) missense possibly damaging 0.93
R8377:Zfy1 UTSW Y 725,723 (GRCm39) missense possibly damaging 0.90
R8795:Zfy1 UTSW Y 738,945 (GRCm39) missense unknown
R8854:Zfy1 UTSW Y 726,501 (GRCm39) missense possibly damaging 0.71
R8936:Zfy1 UTSW Y 738,726 (GRCm39) missense unknown
R9098:Zfy1 UTSW Y 725,987 (GRCm39) missense possibly damaging 0.95
R9146:Zfy1 UTSW Y 726,033 (GRCm39) missense possibly damaging 0.95
R9209:Zfy1 UTSW Y 732,990 (GRCm39) missense unknown
R9310:Zfy1 UTSW Y 727,634 (GRCm39) missense unknown
R9726:Zfy1 UTSW Y 725,476 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CACACTTTGTCAGTCTGTAAAGG -3'
(R):5'- TCAGCTCACACAAAGAATGTTC -3'

Sequencing Primer
(F):5'- AGTCAAATAGGCGCAATATCATC -3'
(R):5'- ATGTTCCATTCAAGTGTAAGAGATG -3'
Posted On 2019-11-26