Incidental Mutation 'R7748:Eef1b2'
ID596954
Institutional Source Beutler Lab
Gene Symbol Eef1b2
Ensembl Gene ENSMUSG00000025967
Gene Nameeukaryotic translation elongation factor 1 beta 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7748 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location63176825-63180486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63177865 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 64 (K64N)
Ref Sequence ENSEMBL: ENSMUSP00000116492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027108] [ENSMUST00000027111] [ENSMUST00000050536] [ENSMUST00000129339] [ENSMUST00000135877] [ENSMUST00000142062] [ENSMUST00000168099] [ENSMUST00000174890] [ENSMUST00000185412] [ENSMUST00000185732] [ENSMUST00000185847] [ENSMUST00000188370] [ENSMUST00000188524] [ENSMUST00000189664]
Predicted Effect probably benign
Transcript: ENSMUST00000027108
Predicted Effect probably benign
Transcript: ENSMUST00000027111
SMART Domains Protein: ENSMUSP00000027111
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 8.5e-20 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:NADH_dhqG_C 658 710 1.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050536
SMART Domains Protein: ENSMUSP00000051417
Gene: ENSMUSG00000046856

DomainStartEndE-ValueType
Pfam:7tm_1 55 302 3.9e-40 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000134341
Gene: ENSMUSG00000025967
AA Change: K60N

DomainStartEndE-ValueType
SCOP:d1aw9_1 4 62 8e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129339
AA Change: K64N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116492
Gene: ENSMUSG00000025967
AA Change: K64N

DomainStartEndE-ValueType
EF-1_beta_acid 103 130 2.53e-4 SMART
EF1_GNE 139 225 3.86e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135877
AA Change: K61M

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137671
Gene: ENSMUSG00000025967
AA Change: K61M

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142062
Predicted Effect probably benign
Transcript: ENSMUST00000168099
SMART Domains Protein: ENSMUSP00000126621
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 4.3e-19 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:DUF1982 657 710 3.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174890
AA Change: K64N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133545
Gene: ENSMUSG00000025967
AA Change: K64N

DomainStartEndE-ValueType
Blast:WHEP 3 64 3e-6 BLAST
SCOP:d1aw9_1 7 65 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185412
SMART Domains Protein: ENSMUSP00000140467
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 79 5.3e-10 PFAM
Pfam:Fer2 34 79 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185732
SMART Domains Protein: ENSMUSP00000140307
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 4.4e-18 PFAM
Pfam:Fer2 34 97 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185847
SMART Domains Protein: ENSMUSP00000141190
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Molybdopterin 1 60 5.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188370
SMART Domains Protein: ENSMUSP00000139664
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 96 1.1e-13 PFAM
Pfam:Fer2 34 127 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188524
SMART Domains Protein: ENSMUSP00000140895
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 62 89 1.2e-8 SMART
EF1_GNE 98 184 2.9e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189664
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5' UTR. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,361,792 L103F probably benign Het
4932438A13Rik A G 3: 36,959,335 probably null Het
5330417H12Rik A G 7: 107,624,558 L103P unknown Het
Actb T C 5: 142,904,695 I151V probably benign Het
Adcy6 T A 15: 98,604,556 H59L probably benign Het
Adss G C 1: 177,772,202 S272* probably null Het
Aga A T 8: 53,511,805 M1L possibly damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgap45 A T 10: 80,016,932 probably benign Het
Atp6v0a2 A T 5: 124,716,496 H639L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bod1l A C 5: 41,832,340 S347A probably damaging Het
Calcoco1 T C 15: 102,719,561 D46G probably damaging Het
Camk1 T C 6: 113,340,328 E60G probably damaging Het
Capza1 A T 3: 104,825,405 probably null Het
Ccdc18 T A 5: 108,149,041 probably null Het
Cdh20 G A 1: 104,941,299 A172T probably damaging Het
Cdk4 C T 10: 127,064,429 A65V possibly damaging Het
Cftr T C 6: 18,277,889 probably null Het
Chd3 T C 11: 69,355,633 M1092V probably benign Het
Chd6 A T 2: 160,966,619 H1558Q probably benign Het
Chil1 A G 1: 134,189,228 H318R probably benign Het
Cps1 A G 1: 67,139,806 Y59C probably damaging Het
Cyb5r4 T C 9: 87,032,381 V111A probably damaging Het
D430042O09Rik A T 7: 125,829,801 M558L probably benign Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dhx57 A G 17: 80,265,117 F709S probably damaging Het
Fam135a A G 1: 24,028,969 S940P probably benign Het
Fam234b T A 6: 135,209,351 V119E probably damaging Het
Fbxo46 G C 7: 19,136,533 C359S probably damaging Het
Fkbp14 C A 6: 54,595,520 probably benign Het
Fmn2 T A 1: 174,666,649 V1243E probably damaging Het
Fsbp C A 4: 11,579,924 T64K probably damaging Het
Fscb A T 12: 64,474,407 M95K probably benign Het
Fyb T G 15: 6,638,826 V500G probably damaging Het
G2e3 A G 12: 51,371,667 N615S probably benign Het
Gart T C 16: 91,630,652 D486G possibly damaging Het
Gas2l2 T A 11: 83,422,398 D696V probably benign Het
Glmn C T 5: 107,562,244 probably null Het
Gm47985 A T 1: 151,182,974 D122V probably damaging Het
Gm49333 A T 16: 20,633,084 D407V probably damaging Het
Gm7168 A G 17: 13,948,652 K94E probably benign Het
Gm996 T A 2: 25,578,959 E313D possibly damaging Het
Gnai2 T C 9: 107,615,735 H323R Het
Helz2 C T 2: 181,234,531 R1390H probably damaging Het
Igf2bp1 T C 11: 95,967,587 M453V probably benign Het
Ighv3-1 C T 12: 113,964,650 V30M probably damaging Het
Inpp5a A T 7: 139,574,995 R343S probably damaging Het
Itga8 T A 2: 12,230,239 I403F possibly damaging Het
Krt33a C T 11: 100,011,602 R404H probably benign Het
Krt34 T A 11: 100,038,938 E244V probably damaging Het
Krt42 T C 11: 100,266,966 E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Lama1 T C 17: 67,750,590 L553P Het
Lcn9 T A 2: 25,824,914 *179K probably null Het
Lrrc2 T G 9: 110,980,931 M345R possibly damaging Het
March11 T C 15: 26,387,830 V257A probably damaging Het
Masp2 T C 4: 148,605,706 I224T probably benign Het
Mpz A T 1: 171,159,940 probably null Het
Mtr C T 13: 12,227,839 A442T probably benign Het
Muc5b A G 7: 141,847,805 K596R unknown Het
Myo15 T G 11: 60,504,901 F1397C Het
Ncor2 T C 5: 125,109,967 I173V unknown Het
Ngly1 T A 14: 16,290,820 I434K possibly damaging Het
Notch2 A G 3: 98,138,484 H1655R possibly damaging Het
Notum C T 11: 120,654,801 A390T probably damaging Het
Olfr381 T G 11: 73,486,168 I219L probably benign Het
Olfr519 T C 7: 108,894,078 T115A probably benign Het
Pds5a T A 5: 65,619,666 I51F possibly damaging Het
Pdzd2 C A 15: 12,385,786 R966L possibly damaging Het
Plk3 T C 4: 117,131,728 Y278C probably damaging Het
Plxna1 C G 6: 89,337,352 probably null Het
Plxna1 T A 6: 89,337,353 probably null Het
Ppp4r4 G A 12: 103,605,061 probably null Het
Pramel6 T A 2: 87,508,699 V81E probably damaging Het
Prdm2 T C 4: 143,135,889 E277G possibly damaging Het
Prkg1 T A 19: 30,993,091 I222F possibly damaging Het
Proser3 A T 7: 30,540,072 S536T possibly damaging Het
Prrt4 C A 6: 29,177,191 G193V probably damaging Het
Ptpn21 A T 12: 98,688,772 H645Q probably benign Het
Ptprd T C 4: 76,099,504 I744V probably null Het
Rad54l2 A G 9: 106,719,034 V235A possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs22 C T 15: 36,122,269 probably null Het
Rtcb A T 10: 85,941,968 D447E probably benign Het
Rtn1 C T 12: 72,216,926 V744I possibly damaging Het
Scfd1 T G 12: 51,389,357 I96M probably benign Het
Serpina3b T C 12: 104,130,463 M1T probably null Het
Slc1a4 T C 11: 20,332,252 Y74C probably damaging Het
Slc9b2 A T 3: 135,326,179 I267F possibly damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Sparc T C 11: 55,398,600 I226V probably benign Het
Spata22 T G 11: 73,336,254 I98S probably null Het
Spef2 C T 15: 9,652,945 V917M probably damaging Het
Sspo C A 6: 48,449,465 C139* probably null Het
Tenm4 A G 7: 96,894,702 D2012G probably damaging Het
Tgm5 G A 2: 121,052,808 R351C probably damaging Het
Tmem145 G A 7: 25,307,328 W82* probably null Het
Tmem159 A T 7: 120,115,479 I64F possibly damaging Het
Topors T A 4: 40,262,654 D210V probably damaging Het
Tssk4 A T 14: 55,651,112 H146L probably damaging Het
Unc93b1 T A 19: 3,935,250 D19E unknown Het
Usp17lc A G 7: 103,418,481 T328A probably damaging Het
Utrn A G 10: 12,614,508 Y43H probably benign Het
Vmn1r25 T A 6: 57,978,564 I247F probably damaging Het
Vmn2r78 A T 7: 86,921,135 Q287L probably benign Het
Vps13c T A 9: 67,963,089 I3170N probably benign Het
Zfc3h1 T A 10: 115,400,815 M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp773 T C 7: 7,132,908 R230G probably benign Het
Other mutations in Eef1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL00861:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL00862:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL00863:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL01642:Eef1b2 APN 1 63177831 missense probably damaging 1.00
R1127:Eef1b2 UTSW 1 63179457 critical splice acceptor site probably null
R1210:Eef1b2 UTSW 1 63177273 missense probably damaging 1.00
R1909:Eef1b2 UTSW 1 63177272 missense probably damaging 0.99
R2045:Eef1b2 UTSW 1 63179487 nonsense probably null
R5129:Eef1b2 UTSW 1 63179580 missense probably damaging 0.96
R6847:Eef1b2 UTSW 1 63178489 missense probably benign 0.32
R8819:Eef1b2 UTSW 1 63178109 unclassified probably benign
R8995:Eef1b2 UTSW 1 63178470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTATGTCATTTACCAGCTAG -3'
(R):5'- ACGGCTTACTCTTTCAGAATGAAC -3'

Sequencing Primer
(F):5'- CTATGTCATTTACCAGCTAGTGTTTG -3'
(R):5'- CACCCTTGCTGGTAGTTTCAGAAG -3'
Posted On2019-11-26