Incidental Mutation 'R7748:Gm47985'
ID 596958
Institutional Source Beutler Lab
Gene Symbol Gm47985
Ensembl Gene ENSMUSG00000114212
Gene Name predicted gene, 47985
Synonyms
MMRRC Submission 045804-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R7748 (G1)
Quality Score 141.008
Status Not validated
Chromosome 1
Chromosomal Location 151182537-151184243 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 151182974 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 122 (D122V)
Ref Sequence ENSEMBL: ENSMUSP00000152996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000225278]
AlphaFold A0A286YCH8
Predicted Effect probably damaging
Transcript: ENSMUST00000225278
AA Change: D122V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,361,792 (GRCm38) L103F probably benign Het
5330417H12Rik A G 7: 107,624,558 (GRCm38) L103P unknown Het
Actb T C 5: 142,904,695 (GRCm38) I151V probably benign Het
Adcy6 T A 15: 98,604,556 (GRCm38) H59L probably benign Het
Adss2 G C 1: 177,772,202 (GRCm38) S272* probably null Het
Aga A T 8: 53,511,805 (GRCm38) M1L possibly damaging Het
Ajm1 T A 2: 25,578,959 (GRCm38) E313D possibly damaging Het
Anxa5 G A 3: 36,465,331 (GRCm38) T3M probably damaging Het
Arhgap45 A T 10: 80,016,932 (GRCm38) probably benign Het
Atp6v0a2 A T 5: 124,716,496 (GRCm38) H639L probably benign Het
BC005537 C T 13: 24,803,399 (GRCm38) R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 (GRCm38) probably benign Het
Bltp1 A G 3: 36,959,335 (GRCm38) probably null Het
Bod1l A C 5: 41,832,340 (GRCm38) S347A probably damaging Het
Calcoco1 T C 15: 102,719,561 (GRCm38) D46G probably damaging Het
Camk1 T C 6: 113,340,328 (GRCm38) E60G probably damaging Het
Capza1 A T 3: 104,825,405 (GRCm38) probably null Het
Ccdc18 T A 5: 108,149,041 (GRCm38) probably null Het
Cdh20 G A 1: 104,941,299 (GRCm38) A172T probably damaging Het
Cdk4 C T 10: 127,064,429 (GRCm38) A65V possibly damaging Het
Cftr T C 6: 18,277,889 (GRCm38) probably null Het
Chd3 T C 11: 69,355,633 (GRCm38) M1092V probably benign Het
Chd6 A T 2: 160,966,619 (GRCm38) H1558Q probably benign Het
Chi3l1 A G 1: 134,189,228 (GRCm38) H318R probably benign Het
Cps1 A G 1: 67,139,806 (GRCm38) Y59C probably damaging Het
Cyb5r4 T C 9: 87,032,381 (GRCm38) V111A probably damaging Het
Ddx39b G A 17: 35,252,750 (GRCm38) V291M probably damaging Het
Dhx57 A G 17: 80,265,117 (GRCm38) F709S probably damaging Het
Eef1b2 A T 1: 63,177,865 (GRCm38) K64N probably damaging Het
Eef1ece2 A T 16: 20,633,084 (GRCm38) D407V probably damaging Het
Fam135a A G 1: 24,028,969 (GRCm38) S940P probably benign Het
Fam234b T A 6: 135,209,351 (GRCm38) V119E probably damaging Het
Fbxo46 G C 7: 19,136,533 (GRCm38) C359S probably damaging Het
Fkbp14 C A 6: 54,595,520 (GRCm38) probably benign Het
Fmn2 T A 1: 174,666,649 (GRCm38) V1243E probably damaging Het
Fsbp C A 4: 11,579,924 (GRCm38) T64K probably damaging Het
Fscb A T 12: 64,474,407 (GRCm38) M95K probably benign Het
Fyb1 T G 15: 6,638,826 (GRCm38) V500G probably damaging Het
G2e3 A G 12: 51,371,667 (GRCm38) N615S probably benign Het
Gart T C 16: 91,630,652 (GRCm38) D486G possibly damaging Het
Gas2l2 T A 11: 83,422,398 (GRCm38) D696V probably benign Het
Glmn C T 5: 107,562,244 (GRCm38) probably null Het
Gm7168 A G 17: 13,948,652 (GRCm38) K94E probably benign Het
Gnai2 T C 9: 107,615,735 (GRCm38) H323R Het
Helz2 C T 2: 181,234,531 (GRCm38) R1390H probably damaging Het
Igf2bp1 T C 11: 95,967,587 (GRCm38) M453V probably benign Het
Ighv3-1 C T 12: 113,964,650 (GRCm38) V30M probably damaging Het
Inpp5a A T 7: 139,574,995 (GRCm38) R343S probably damaging Het
Itga8 T A 2: 12,230,239 (GRCm38) I403F possibly damaging Het
Katnip A T 7: 125,829,801 (GRCm38) M558L probably benign Het
Krt33a C T 11: 100,011,602 (GRCm38) R404H probably benign Het
Krt34 T A 11: 100,038,938 (GRCm38) E244V probably damaging Het
Krt42 T C 11: 100,266,966 (GRCm38) E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 (GRCm38) probably benign Het
Lama1 T C 17: 67,750,590 (GRCm38) L553P Het
Lcn9 T A 2: 25,824,914 (GRCm38) *179K probably null Het
Ldaf1 A T 7: 120,115,479 (GRCm38) I64F possibly damaging Het
Lrrc2 T G 9: 110,980,931 (GRCm38) M345R possibly damaging Het
Marchf11 T C 15: 26,387,830 (GRCm38) V257A probably damaging Het
Masp2 T C 4: 148,605,706 (GRCm38) I224T probably benign Het
Mpz A T 1: 171,159,940 (GRCm38) probably null Het
Mtr C T 13: 12,227,839 (GRCm38) A442T probably benign Het
Muc5b A G 7: 141,847,805 (GRCm38) K596R unknown Het
Myo15a T G 11: 60,504,901 (GRCm38) F1397C Het
Ncor2 T C 5: 125,109,967 (GRCm38) I173V unknown Het
Ngly1 T A 14: 16,290,820 (GRCm38) I434K possibly damaging Het
Notch2 A G 3: 98,138,484 (GRCm38) H1655R possibly damaging Het
Notum C T 11: 120,654,801 (GRCm38) A390T probably damaging Het
Or10a3n T C 7: 108,894,078 (GRCm38) T115A probably benign Het
Or1e22 T G 11: 73,486,168 (GRCm38) I219L probably benign Het
Pds5a T A 5: 65,619,666 (GRCm38) I51F possibly damaging Het
Pdzd2 C A 15: 12,385,786 (GRCm38) R966L possibly damaging Het
Plk3 T C 4: 117,131,728 (GRCm38) Y278C probably damaging Het
Plxna1 T A 6: 89,337,353 (GRCm38) probably null Het
Plxna1 C G 6: 89,337,352 (GRCm38) probably null Het
Ppp4r4 G A 12: 103,605,061 (GRCm38) probably null Het
Pramel6 T A 2: 87,508,699 (GRCm38) V81E probably damaging Het
Prdm2 T C 4: 143,135,889 (GRCm38) E277G possibly damaging Het
Prkg1 T A 19: 30,993,091 (GRCm38) I222F possibly damaging Het
Proser3 A T 7: 30,540,072 (GRCm38) S536T possibly damaging Het
Prrt4 C A 6: 29,177,191 (GRCm38) G193V probably damaging Het
Ptpn21 A T 12: 98,688,772 (GRCm38) H645Q probably benign Het
Ptprd T C 4: 76,099,504 (GRCm38) I744V probably null Het
Rad54l2 A G 9: 106,719,034 (GRCm38) V235A possibly damaging Het
Repin1 G T 6: 48,597,345 (GRCm38) E403* probably null Het
Rgs22 C T 15: 36,122,269 (GRCm38) probably null Het
Rtcb A T 10: 85,941,968 (GRCm38) D447E probably benign Het
Rtn1 C T 12: 72,216,926 (GRCm38) V744I possibly damaging Het
Scfd1 T G 12: 51,389,357 (GRCm38) I96M probably benign Het
Serpina3b T C 12: 104,130,463 (GRCm38) M1T probably null Het
Slc1a4 T C 11: 20,332,252 (GRCm38) Y74C probably damaging Het
Slc9b2 A T 3: 135,326,179 (GRCm38) I267F possibly damaging Het
Sorcs2 A T 5: 36,229,175 (GRCm38) M173K possibly damaging Het
Sparc T C 11: 55,398,600 (GRCm38) I226V probably benign Het
Spata22 T G 11: 73,336,254 (GRCm38) I98S probably null Het
Spef2 C T 15: 9,652,945 (GRCm38) V917M probably damaging Het
Sspo C A 6: 48,449,465 (GRCm38) C139* probably null Het
Tenm4 A G 7: 96,894,702 (GRCm38) D2012G probably damaging Het
Tgm5 G A 2: 121,052,808 (GRCm38) R351C probably damaging Het
Tmem145 G A 7: 25,307,328 (GRCm38) W82* probably null Het
Topors T A 4: 40,262,654 (GRCm38) D210V probably damaging Het
Tssk4 A T 14: 55,651,112 (GRCm38) H146L probably damaging Het
Unc93b1 T A 19: 3,935,250 (GRCm38) D19E unknown Het
Usp17lc A G 7: 103,418,481 (GRCm38) T328A probably damaging Het
Utrn A G 10: 12,614,508 (GRCm38) Y43H probably benign Het
Vmn1r25 T A 6: 57,978,564 (GRCm38) I247F probably damaging Het
Vmn2r78 A T 7: 86,921,135 (GRCm38) Q287L probably benign Het
Vps13c T A 9: 67,963,089 (GRCm38) I3170N probably benign Het
Zfc3h1 T A 10: 115,400,815 (GRCm38) M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 (GRCm38) probably benign Het
Zfp773 T C 7: 7,132,908 (GRCm38) R230G probably benign Het
Other mutations in Gm47985
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6821:Gm47985 UTSW 1 151,183,036 (GRCm38) missense possibly damaging 0.66
R7052:Gm47985 UTSW 1 151,183,139 (GRCm38) missense possibly damaging 0.46
R7067:Gm47985 UTSW 1 151,183,490 (GRCm38) missense unknown
Z1176:Gm47985 UTSW 1 151,183,141 (GRCm38) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGTTCCAAGTCCTCTCCCATGG -3'
(R):5'- TGAAGACTCTGGACATGAGCAG -3'

Sequencing Primer
(F):5'- AGTCCTCTCCCATGGGCAAAG -3'
(R):5'- CAGCGAGAATGTTGGTAATGAGCTG -3'
Posted On 2019-11-26