Incidental Mutation 'R7748:Mpz'
ID 596959
Institutional Source Beutler Lab
Gene Symbol Mpz
Ensembl Gene ENSMUSG00000056569
Gene Name myelin protein zero
Synonyms Mpp, P0
MMRRC Submission 045804-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R7748 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 170978282-170988699 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 170987509 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070758] [ENSMUST00000111334]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000070758
SMART Domains Protein: ENSMUSP00000066701
Gene: ENSMUSG00000056569

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGv 45 129 1.39e-11 SMART
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Myelin-PO_C 184 248 4.3e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111334
SMART Domains Protein: ENSMUSP00000106966
Gene: ENSMUSG00000056569

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
IGv 45 129 1.39e-11 SMART
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Myelin-PO_C 179 248 4.8e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is specifically expressed in Schwann cells of the peripheral nervous system and encodes a type I transmembrane glycoprotein that is a major structural protein of the peripheral myelin sheath. The encoded protein contains a large hydrophobic extracellular domain and a smaller basic intracellular domain, which are essential for the formation and stabilization of the multilamellar structure of the compact myelin. Mutations in the orthologous gene in human are associated with myelinating neuropathies. A recent study showed that two isoforms are produced from the same mRNA by use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit premature death, infertility, neurological behavior defects, and demyelination. Mice homozygous for a knock-out allele exhibit abnormal myelination and neurological behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 130,963,521 (GRCm39) L103F probably benign Het
5330417H12Rik A G 7: 107,223,765 (GRCm39) L103P unknown Het
Actb T C 5: 142,890,450 (GRCm39) I151V probably benign Het
Adcy6 T A 15: 98,502,437 (GRCm39) H59L probably benign Het
Adss2 G C 1: 177,599,768 (GRCm39) S272* probably null Het
Aga A T 8: 53,964,840 (GRCm39) M1L possibly damaging Het
Ajm1 T A 2: 25,468,971 (GRCm39) E313D possibly damaging Het
Anxa5 G A 3: 36,519,480 (GRCm39) T3M probably damaging Het
Arhgap45 A T 10: 79,852,766 (GRCm39) probably benign Het
Atp6v0a2 A T 5: 124,793,560 (GRCm39) H639L probably benign Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bltp1 A G 3: 37,013,484 (GRCm39) probably null Het
Bod1l A C 5: 41,989,683 (GRCm39) S347A probably damaging Het
Calcoco1 T C 15: 102,627,996 (GRCm39) D46G probably damaging Het
Camk1 T C 6: 113,317,289 (GRCm39) E60G probably damaging Het
Capza1 A T 3: 104,732,721 (GRCm39) probably null Het
Ccdc18 T A 5: 108,296,907 (GRCm39) probably null Het
Cdh20 G A 1: 104,869,024 (GRCm39) A172T probably damaging Het
Cdk4 C T 10: 126,900,298 (GRCm39) A65V possibly damaging Het
Cftr T C 6: 18,277,888 (GRCm39) probably null Het
Chd3 T C 11: 69,246,459 (GRCm39) M1092V probably benign Het
Chd6 A T 2: 160,808,539 (GRCm39) H1558Q probably benign Het
Chi3l1 A G 1: 134,116,966 (GRCm39) H318R probably benign Het
Cps1 A G 1: 67,178,965 (GRCm39) Y59C probably damaging Het
Cyb5r4 T C 9: 86,914,434 (GRCm39) V111A probably damaging Het
Ddx39b G A 17: 35,471,726 (GRCm39) V291M probably damaging Het
Dhx57 A G 17: 80,572,546 (GRCm39) F709S probably damaging Het
Eef1b2 A T 1: 63,217,024 (GRCm39) K64N probably damaging Het
Eef1ece2 A T 16: 20,451,834 (GRCm39) D407V probably damaging Het
Fam135a A G 1: 24,068,050 (GRCm39) S940P probably benign Het
Fam234b T A 6: 135,186,349 (GRCm39) V119E probably damaging Het
Fbxo46 G C 7: 18,870,458 (GRCm39) C359S probably damaging Het
Fkbp14 C A 6: 54,572,505 (GRCm39) probably benign Het
Fmn2 T A 1: 174,494,215 (GRCm39) V1243E probably damaging Het
Fsbp C A 4: 11,579,924 (GRCm39) T64K probably damaging Het
Fscb A T 12: 64,521,181 (GRCm39) M95K probably benign Het
Fyb1 T G 15: 6,668,307 (GRCm39) V500G probably damaging Het
G2e3 A G 12: 51,418,450 (GRCm39) N615S probably benign Het
Gart T C 16: 91,427,540 (GRCm39) D486G possibly damaging Het
Gas2l2 T A 11: 83,313,224 (GRCm39) D696V probably benign Het
Glmn C T 5: 107,710,110 (GRCm39) probably null Het
Gm47985 A T 1: 151,058,725 (GRCm39) D122V probably damaging Het
Gm7168 A G 17: 14,168,914 (GRCm39) K94E probably benign Het
Gnai2 T C 9: 107,492,934 (GRCm39) H323R Het
Helz2 C T 2: 180,876,324 (GRCm39) R1390H probably damaging Het
Igf2bp1 T C 11: 95,858,413 (GRCm39) M453V probably benign Het
Ighv3-1 C T 12: 113,928,270 (GRCm39) V30M probably damaging Het
Inpp5a A T 7: 139,154,911 (GRCm39) R343S probably damaging Het
Itga8 T A 2: 12,235,050 (GRCm39) I403F possibly damaging Het
Katnip A T 7: 125,428,973 (GRCm39) M558L probably benign Het
Krt33a C T 11: 99,902,428 (GRCm39) R404H probably benign Het
Krt34 T A 11: 99,929,764 (GRCm39) E244V probably damaging Het
Krt42 T C 11: 100,157,792 (GRCm39) E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 141,728,845 (GRCm39) probably benign Het
Lama1 T C 17: 68,057,585 (GRCm39) L553P Het
Lcn9 T A 2: 25,714,926 (GRCm39) *179K probably null Het
Ldaf1 A T 7: 119,714,702 (GRCm39) I64F possibly damaging Het
Lrrc2 T G 9: 110,809,999 (GRCm39) M345R possibly damaging Het
Marchf11 T C 15: 26,387,916 (GRCm39) V257A probably damaging Het
Masp2 T C 4: 148,690,163 (GRCm39) I224T probably benign Het
Mtr C T 13: 12,242,725 (GRCm39) A442T probably benign Het
Muc5b A G 7: 141,401,542 (GRCm39) K596R unknown Het
Myo15a T G 11: 60,395,727 (GRCm39) F1397C Het
Ncor2 T C 5: 125,187,031 (GRCm39) I173V unknown Het
Ngly1 T A 14: 16,290,820 (GRCm38) I434K possibly damaging Het
Notch2 A G 3: 98,045,800 (GRCm39) H1655R possibly damaging Het
Notum C T 11: 120,545,627 (GRCm39) A390T probably damaging Het
Or10a3n T C 7: 108,493,285 (GRCm39) T115A probably benign Het
Or1e22 T G 11: 73,376,994 (GRCm39) I219L probably benign Het
Pds5a T A 5: 65,777,009 (GRCm39) I51F possibly damaging Het
Pdzd2 C A 15: 12,385,872 (GRCm39) R966L possibly damaging Het
Plk3 T C 4: 116,988,925 (GRCm39) Y278C probably damaging Het
Plxna1 C G 6: 89,314,334 (GRCm39) probably null Het
Plxna1 T A 6: 89,314,335 (GRCm39) probably null Het
Ppp4r4 G A 12: 103,571,320 (GRCm39) probably null Het
Pramel6 T A 2: 87,339,043 (GRCm39) V81E probably damaging Het
Prdm2 T C 4: 142,862,459 (GRCm39) E277G possibly damaging Het
Prkg1 T A 19: 30,970,491 (GRCm39) I222F possibly damaging Het
Proser3 A T 7: 30,239,497 (GRCm39) S536T possibly damaging Het
Prrt4 C A 6: 29,177,190 (GRCm39) G193V probably damaging Het
Ptpn21 A T 12: 98,655,031 (GRCm39) H645Q probably benign Het
Ptprd T C 4: 76,017,741 (GRCm39) I744V probably null Het
Rad54l2 A G 9: 106,596,233 (GRCm39) V235A possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rgs22 C T 15: 36,122,415 (GRCm39) probably null Het
Rtcb A T 10: 85,777,832 (GRCm39) D447E probably benign Het
Rtn1 C T 12: 72,263,700 (GRCm39) V744I possibly damaging Het
Scfd1 T G 12: 51,436,140 (GRCm39) I96M probably benign Het
Serpina3b T C 12: 104,096,722 (GRCm39) M1T probably null Het
Slc1a4 T C 11: 20,282,252 (GRCm39) Y74C probably damaging Het
Slc9b2 A T 3: 135,031,940 (GRCm39) I267F possibly damaging Het
Sorcs2 A T 5: 36,386,519 (GRCm39) M173K possibly damaging Het
Sparc T C 11: 55,289,426 (GRCm39) I226V probably benign Het
Spata22 T G 11: 73,227,080 (GRCm39) I98S probably null Het
Spef2 C T 15: 9,653,031 (GRCm39) V917M probably damaging Het
Sspo C A 6: 48,426,399 (GRCm39) C139* probably null Het
Tenm4 A G 7: 96,543,909 (GRCm39) D2012G probably damaging Het
Tgm5 G A 2: 120,883,289 (GRCm39) R351C probably damaging Het
Tmem145 G A 7: 25,006,753 (GRCm39) W82* probably null Het
Topors T A 4: 40,262,654 (GRCm39) D210V probably damaging Het
Tssk4 A T 14: 55,888,569 (GRCm39) H146L probably damaging Het
Unc93b1 T A 19: 3,985,250 (GRCm39) D19E unknown Het
Usp17lc A G 7: 103,067,688 (GRCm39) T328A probably damaging Het
Utrn A G 10: 12,490,252 (GRCm39) Y43H probably benign Het
Vmn1r25 T A 6: 57,955,549 (GRCm39) I247F probably damaging Het
Vmn2r78 A T 7: 86,570,343 (GRCm39) Q287L probably benign Het
Vps13c T A 9: 67,870,371 (GRCm39) I3170N probably benign Het
Zfc3h1 T A 10: 115,236,720 (GRCm39) M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp773 T C 7: 7,135,907 (GRCm39) R230G probably benign Het
Other mutations in Mpz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Mpz APN 1 170,987,571 (GRCm39) missense possibly damaging 0.84
IGL03051:Mpz APN 1 170,986,380 (GRCm39) missense probably damaging 1.00
Half-pint UTSW 1 170,987,204 (GRCm39) critical splice donor site probably null
taz UTSW 1 170,986,379 (GRCm39) missense probably damaging 1.00
R0279:Mpz UTSW 1 170,987,498 (GRCm39) splice site probably benign
R0791:Mpz UTSW 1 170,986,343 (GRCm39) missense possibly damaging 0.85
R1164:Mpz UTSW 1 170,986,008 (GRCm39) missense possibly damaging 0.92
R1368:Mpz UTSW 1 170,987,533 (GRCm39) missense probably damaging 1.00
R4043:Mpz UTSW 1 170,987,340 (GRCm39) splice site probably benign
R4857:Mpz UTSW 1 170,986,379 (GRCm39) missense probably damaging 1.00
R5682:Mpz UTSW 1 170,986,463 (GRCm39) missense possibly damaging 0.62
R6709:Mpz UTSW 1 170,978,301 (GRCm39) unclassified probably benign
R7089:Mpz UTSW 1 170,987,204 (GRCm39) critical splice donor site probably null
R7888:Mpz UTSW 1 170,987,204 (GRCm39) critical splice donor site probably null
R8023:Mpz UTSW 1 170,987,602 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGACTGCTTCAGTGGTGG -3'
(R):5'- ATCTCGATGACCACCACCTG -3'

Sequencing Primer
(F):5'- GTTTCAGGGAGGCCAATCC -3'
(R):5'- CTGAGAGCCTTTGGAGGACTC -3'
Posted On 2019-11-26