Incidental Mutation 'R7748:Itga8'
ID 596962
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock # R7748 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 12106632-12301922 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12230239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 403 (I403F)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect possibly damaging
Transcript: ENSMUST00000028106
AA Change: I403F

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: I403F

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172791
AA Change: I403F

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: I403F

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,361,792 L103F probably benign Het
4932438A13Rik A G 3: 36,959,335 probably null Het
5330417H12Rik A G 7: 107,624,558 L103P unknown Het
Actb T C 5: 142,904,695 I151V probably benign Het
Adcy6 T A 15: 98,604,556 H59L probably benign Het
Adss G C 1: 177,772,202 S272* probably null Het
Aga A T 8: 53,511,805 M1L possibly damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgap45 A T 10: 80,016,932 probably benign Het
Atp6v0a2 A T 5: 124,716,496 H639L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bod1l A C 5: 41,832,340 S347A probably damaging Het
Calcoco1 T C 15: 102,719,561 D46G probably damaging Het
Camk1 T C 6: 113,340,328 E60G probably damaging Het
Capza1 A T 3: 104,825,405 probably null Het
Ccdc18 T A 5: 108,149,041 probably null Het
Cdh20 G A 1: 104,941,299 A172T probably damaging Het
Cdk4 C T 10: 127,064,429 A65V possibly damaging Het
Cftr T C 6: 18,277,889 probably null Het
Chd3 T C 11: 69,355,633 M1092V probably benign Het
Chd6 A T 2: 160,966,619 H1558Q probably benign Het
Chil1 A G 1: 134,189,228 H318R probably benign Het
Cps1 A G 1: 67,139,806 Y59C probably damaging Het
Cyb5r4 T C 9: 87,032,381 V111A probably damaging Het
D430042O09Rik A T 7: 125,829,801 M558L probably benign Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dhx57 A G 17: 80,265,117 F709S probably damaging Het
Eef1b2 A T 1: 63,177,865 K64N probably damaging Het
Fam135a A G 1: 24,028,969 S940P probably benign Het
Fam234b T A 6: 135,209,351 V119E probably damaging Het
Fbxo46 G C 7: 19,136,533 C359S probably damaging Het
Fkbp14 C A 6: 54,595,520 probably benign Het
Fmn2 T A 1: 174,666,649 V1243E probably damaging Het
Fsbp C A 4: 11,579,924 T64K probably damaging Het
Fscb A T 12: 64,474,407 M95K probably benign Het
Fyb T G 15: 6,638,826 V500G probably damaging Het
G2e3 A G 12: 51,371,667 N615S probably benign Het
Gart T C 16: 91,630,652 D486G possibly damaging Het
Gas2l2 T A 11: 83,422,398 D696V probably benign Het
Glmn C T 5: 107,562,244 probably null Het
Gm47985 A T 1: 151,182,974 D122V probably damaging Het
Gm49333 A T 16: 20,633,084 D407V probably damaging Het
Gm7168 A G 17: 13,948,652 K94E probably benign Het
Gm996 T A 2: 25,578,959 E313D possibly damaging Het
Gnai2 T C 9: 107,615,735 H323R Het
Helz2 C T 2: 181,234,531 R1390H probably damaging Het
Igf2bp1 T C 11: 95,967,587 M453V probably benign Het
Ighv3-1 C T 12: 113,964,650 V30M probably damaging Het
Inpp5a A T 7: 139,574,995 R343S probably damaging Het
Krt33a C T 11: 100,011,602 R404H probably benign Het
Krt34 T A 11: 100,038,938 E244V probably damaging Het
Krt42 T C 11: 100,266,966 E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Lama1 T C 17: 67,750,590 L553P Het
Lcn9 T A 2: 25,824,914 *179K probably null Het
Lrrc2 T G 9: 110,980,931 M345R possibly damaging Het
March11 T C 15: 26,387,830 V257A probably damaging Het
Masp2 T C 4: 148,605,706 I224T probably benign Het
Mpz A T 1: 171,159,940 probably null Het
Mtr C T 13: 12,227,839 A442T probably benign Het
Muc5b A G 7: 141,847,805 K596R unknown Het
Myo15 T G 11: 60,504,901 F1397C Het
Ncor2 T C 5: 125,109,967 I173V unknown Het
Ngly1 T A 14: 16,290,820 I434K possibly damaging Het
Notch2 A G 3: 98,138,484 H1655R possibly damaging Het
Notum C T 11: 120,654,801 A390T probably damaging Het
Olfr381 T G 11: 73,486,168 I219L probably benign Het
Olfr519 T C 7: 108,894,078 T115A probably benign Het
Pds5a T A 5: 65,619,666 I51F possibly damaging Het
Pdzd2 C A 15: 12,385,786 R966L possibly damaging Het
Plk3 T C 4: 117,131,728 Y278C probably damaging Het
Plxna1 C G 6: 89,337,352 probably null Het
Plxna1 T A 6: 89,337,353 probably null Het
Ppp4r4 G A 12: 103,605,061 probably null Het
Pramel6 T A 2: 87,508,699 V81E probably damaging Het
Prdm2 T C 4: 143,135,889 E277G possibly damaging Het
Prkg1 T A 19: 30,993,091 I222F possibly damaging Het
Proser3 A T 7: 30,540,072 S536T possibly damaging Het
Prrt4 C A 6: 29,177,191 G193V probably damaging Het
Ptpn21 A T 12: 98,688,772 H645Q probably benign Het
Ptprd T C 4: 76,099,504 I744V probably null Het
Rad54l2 A G 9: 106,719,034 V235A possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs22 C T 15: 36,122,269 probably null Het
Rtcb A T 10: 85,941,968 D447E probably benign Het
Rtn1 C T 12: 72,216,926 V744I possibly damaging Het
Scfd1 T G 12: 51,389,357 I96M probably benign Het
Serpina3b T C 12: 104,130,463 M1T probably null Het
Slc1a4 T C 11: 20,332,252 Y74C probably damaging Het
Slc9b2 A T 3: 135,326,179 I267F possibly damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Sparc T C 11: 55,398,600 I226V probably benign Het
Spata22 T G 11: 73,336,254 I98S probably null Het
Spef2 C T 15: 9,652,945 V917M probably damaging Het
Sspo C A 6: 48,449,465 C139* probably null Het
Tenm4 A G 7: 96,894,702 D2012G probably damaging Het
Tgm5 G A 2: 121,052,808 R351C probably damaging Het
Tmem145 G A 7: 25,307,328 W82* probably null Het
Tmem159 A T 7: 120,115,479 I64F possibly damaging Het
Topors T A 4: 40,262,654 D210V probably damaging Het
Tssk4 A T 14: 55,651,112 H146L probably damaging Het
Unc93b1 T A 19: 3,935,250 D19E unknown Het
Usp17lc A G 7: 103,418,481 T328A probably damaging Het
Utrn A G 10: 12,614,508 Y43H probably benign Het
Vmn1r25 T A 6: 57,978,564 I247F probably damaging Het
Vmn2r78 A T 7: 86,921,135 Q287L probably benign Het
Vps13c T A 9: 67,963,089 I3170N probably benign Het
Zfc3h1 T A 10: 115,400,815 M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp773 T C 7: 7,132,908 R230G probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12255966 nonsense probably null
IGL00820:Itga8 APN 2 12232892 missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12191714 missense probably benign
IGL01508:Itga8 APN 2 12232802 missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12160312 splice site probably benign
IGL01590:Itga8 APN 2 12160333 missense probably damaging 1.00
IGL01743:Itga8 APN 2 12265333 missense probably benign 0.04
IGL02634:Itga8 APN 2 12140478 missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12189480 missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12191199 missense probably benign 0.00
IGL03218:Itga8 APN 2 12111025 missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12132516 missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12230092 missense probably benign 0.19
R0196:Itga8 UTSW 2 12204729 critical splice donor site probably null
R0356:Itga8 UTSW 2 12182721 missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12232886 missense probably damaging 1.00
R0530:Itga8 UTSW 2 12191816 missense probably damaging 0.99
R0715:Itga8 UTSW 2 12191242 splice site probably benign
R0800:Itga8 UTSW 2 12193551 missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12262192 splice site probably null
R1675:Itga8 UTSW 2 12200163 missense probably damaging 0.99
R1758:Itga8 UTSW 2 12265333 missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12300846 missense probably damaging 1.00
R2187:Itga8 UTSW 2 12194420 missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12182709 missense probably benign 0.38
R2356:Itga8 UTSW 2 12200141 missense probably benign
R2371:Itga8 UTSW 2 12253466 missense probably damaging 1.00
R2412:Itga8 UTSW 2 12301715 missense probably benign
R2440:Itga8 UTSW 2 12178680 missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12160404 missense probably damaging 0.98
R3730:Itga8 UTSW 2 12193510 missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12189519 missense probably benign
R3982:Itga8 UTSW 2 12300963 missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4514:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4660:Itga8 UTSW 2 12265258 missense probably damaging 1.00
R4890:Itga8 UTSW 2 12193291 splice site probably benign
R5533:Itga8 UTSW 2 12160350 missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12265328 missense probably damaging 1.00
R5720:Itga8 UTSW 2 12111087 missense probably damaging 0.99
R5749:Itga8 UTSW 2 12262078 missense probably damaging 1.00
R5930:Itga8 UTSW 2 12230208 missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12132486 missense probably damaging 0.99
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6211:Itga8 UTSW 2 12193509 missense probably damaging 1.00
R6337:Itga8 UTSW 2 12253469 nonsense probably null
R6442:Itga8 UTSW 2 12230143 missense probably benign 0.00
R6491:Itga8 UTSW 2 12204776 missense probably damaging 1.00
R6543:Itga8 UTSW 2 12301644 missense probably damaging 0.99
R6574:Itga8 UTSW 2 12230161 missense probably benign 0.17
R6760:Itga8 UTSW 2 12301640 missense probably damaging 1.00
R6858:Itga8 UTSW 2 12200081 missense probably benign 0.00
R6943:Itga8 UTSW 2 12155371 critical splice donor site probably null
R7048:Itga8 UTSW 2 12111084 missense probably damaging 0.99
R7203:Itga8 UTSW 2 12230095 missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12232901 missense probably damaging 1.00
R7323:Itga8 UTSW 2 12262129 missense probably damaging 1.00
R7540:Itga8 UTSW 2 12111037 missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12109187 missense probably damaging 1.00
R7848:Itga8 UTSW 2 12191737 missense probably damaging 0.99
R8031:Itga8 UTSW 2 12155486 missense probably benign
R8077:Itga8 UTSW 2 12242433 missense probably benign 0.09
R8757:Itga8 UTSW 2 12262129 missense probably damaging 1.00
R8759:Itga8 UTSW 2 12262129 missense probably damaging 1.00
R8772:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8773:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8774:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8775:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12182684 missense probably damaging 1.00
R8808:Itga8 UTSW 2 12132517 nonsense probably null
R8898:Itga8 UTSW 2 12140395 missense probably benign 0.05
R8962:Itga8 UTSW 2 12191234 missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12230208 missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12189519 missense probably benign
R9354:Itga8 UTSW 2 12232857 missense possibly damaging 0.94
Z1176:Itga8 UTSW 2 12247518 missense probably damaging 1.00
Z1176:Itga8 UTSW 2 12262136 missense probably benign 0.01
Z1176:Itga8 UTSW 2 12301832 start gained probably benign
Z1177:Itga8 UTSW 2 12300933 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GAACCTTACCTGGGTAATCATTCTTG -3'
(R):5'- ATTTGGACCCTGGGGCATTG -3'

Sequencing Primer
(F):5'- ACCTGGGTAATCATTCTTGTCTATG -3'
(R):5'- GGCATTGCCTTTGGATTGC -3'
Posted On 2019-11-26