Incidental Mutation 'R7748:Helz2'
ID596968
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Namehelicase with zinc finger 2, transcriptional coactivator
SynonymsBC006779
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7748 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location181227615-181242027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 181234531 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1390 (R1390H)
Ref Sequence ENSEMBL: ENSMUSP00000091756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
Predicted Effect probably damaging
Transcript: ENSMUST00000094203
AA Change: R1390H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: R1390H

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108831
AA Change: R1390H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: R1390H

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121484
AA Change: R1390H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: R1390H

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,361,792 L103F probably benign Het
4932438A13Rik A G 3: 36,959,335 probably null Het
5330417H12Rik A G 7: 107,624,558 L103P unknown Het
Actb T C 5: 142,904,695 I151V probably benign Het
Adcy6 T A 15: 98,604,556 H59L probably benign Het
Adss G C 1: 177,772,202 S272* probably null Het
Aga A T 8: 53,511,805 M1L possibly damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgap45 A T 10: 80,016,932 probably benign Het
Atp6v0a2 A T 5: 124,716,496 H639L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bod1l A C 5: 41,832,340 S347A probably damaging Het
Calcoco1 T C 15: 102,719,561 D46G probably damaging Het
Camk1 T C 6: 113,340,328 E60G probably damaging Het
Capza1 A T 3: 104,825,405 probably null Het
Ccdc18 T A 5: 108,149,041 probably null Het
Cdh20 G A 1: 104,941,299 A172T probably damaging Het
Cdk4 C T 10: 127,064,429 A65V possibly damaging Het
Cftr T C 6: 18,277,889 probably null Het
Chd3 T C 11: 69,355,633 M1092V probably benign Het
Chd6 A T 2: 160,966,619 H1558Q probably benign Het
Chil1 A G 1: 134,189,228 H318R probably benign Het
Cps1 A G 1: 67,139,806 Y59C probably damaging Het
Cyb5r4 T C 9: 87,032,381 V111A probably damaging Het
D430042O09Rik A T 7: 125,829,801 M558L probably benign Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dhx57 A G 17: 80,265,117 F709S probably damaging Het
Eef1b2 A T 1: 63,177,865 K64N probably damaging Het
Fam135a A G 1: 24,028,969 S940P probably benign Het
Fam234b T A 6: 135,209,351 V119E probably damaging Het
Fbxo46 G C 7: 19,136,533 C359S probably damaging Het
Fkbp14 C A 6: 54,595,520 probably benign Het
Fmn2 T A 1: 174,666,649 V1243E probably damaging Het
Fsbp C A 4: 11,579,924 T64K probably damaging Het
Fscb A T 12: 64,474,407 M95K probably benign Het
Fyb T G 15: 6,638,826 V500G probably damaging Het
G2e3 A G 12: 51,371,667 N615S probably benign Het
Gart T C 16: 91,630,652 D486G possibly damaging Het
Gas2l2 T A 11: 83,422,398 D696V probably benign Het
Glmn C T 5: 107,562,244 probably null Het
Gm47985 A T 1: 151,182,974 D122V probably damaging Het
Gm49333 A T 16: 20,633,084 D407V probably damaging Het
Gm7168 A G 17: 13,948,652 K94E probably benign Het
Gm996 T A 2: 25,578,959 E313D possibly damaging Het
Gnai2 T C 9: 107,615,735 H323R Het
Igf2bp1 T C 11: 95,967,587 M453V probably benign Het
Ighv3-1 C T 12: 113,964,650 V30M probably damaging Het
Inpp5a A T 7: 139,574,995 R343S probably damaging Het
Itga8 T A 2: 12,230,239 I403F possibly damaging Het
Krt33a C T 11: 100,011,602 R404H probably benign Het
Krt34 T A 11: 100,038,938 E244V probably damaging Het
Krt42 T C 11: 100,266,966 E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Lama1 T C 17: 67,750,590 L553P Het
Lcn9 T A 2: 25,824,914 *179K probably null Het
Lrrc2 T G 9: 110,980,931 M345R possibly damaging Het
March11 T C 15: 26,387,830 V257A probably damaging Het
Masp2 T C 4: 148,605,706 I224T probably benign Het
Mpz A T 1: 171,159,940 probably null Het
Mtr C T 13: 12,227,839 A442T probably benign Het
Muc5b A G 7: 141,847,805 K596R unknown Het
Myo15 T G 11: 60,504,901 F1397C Het
Ncor2 T C 5: 125,109,967 I173V unknown Het
Ngly1 T A 14: 16,290,820 I434K possibly damaging Het
Notch2 A G 3: 98,138,484 H1655R possibly damaging Het
Notum C T 11: 120,654,801 A390T probably damaging Het
Olfr381 T G 11: 73,486,168 I219L probably benign Het
Olfr519 T C 7: 108,894,078 T115A probably benign Het
Pds5a T A 5: 65,619,666 I51F possibly damaging Het
Pdzd2 C A 15: 12,385,786 R966L possibly damaging Het
Plk3 T C 4: 117,131,728 Y278C probably damaging Het
Plxna1 C G 6: 89,337,352 probably null Het
Plxna1 T A 6: 89,337,353 probably null Het
Ppp4r4 G A 12: 103,605,061 probably null Het
Pramel6 T A 2: 87,508,699 V81E probably damaging Het
Prdm2 T C 4: 143,135,889 E277G possibly damaging Het
Prkg1 T A 19: 30,993,091 I222F possibly damaging Het
Proser3 A T 7: 30,540,072 S536T possibly damaging Het
Prrt4 C A 6: 29,177,191 G193V probably damaging Het
Ptpn21 A T 12: 98,688,772 H645Q probably benign Het
Ptprd T C 4: 76,099,504 I744V probably null Het
Rad54l2 A G 9: 106,719,034 V235A possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs22 C T 15: 36,122,269 probably null Het
Rtcb A T 10: 85,941,968 D447E probably benign Het
Rtn1 C T 12: 72,216,926 V744I possibly damaging Het
Scfd1 T G 12: 51,389,357 I96M probably benign Het
Serpina3b T C 12: 104,130,463 M1T probably null Het
Slc1a4 T C 11: 20,332,252 Y74C probably damaging Het
Slc9b2 A T 3: 135,326,179 I267F possibly damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Sparc T C 11: 55,398,600 I226V probably benign Het
Spata22 T G 11: 73,336,254 I98S probably null Het
Spef2 C T 15: 9,652,945 V917M probably damaging Het
Sspo C A 6: 48,449,465 C139* probably null Het
Tenm4 A G 7: 96,894,702 D2012G probably damaging Het
Tgm5 G A 2: 121,052,808 R351C probably damaging Het
Tmem145 G A 7: 25,307,328 W82* probably null Het
Tmem159 A T 7: 120,115,479 I64F possibly damaging Het
Topors T A 4: 40,262,654 D210V probably damaging Het
Tssk4 A T 14: 55,651,112 H146L probably damaging Het
Unc93b1 T A 19: 3,935,250 D19E unknown Het
Usp17lc A G 7: 103,418,481 T328A probably damaging Het
Utrn A G 10: 12,614,508 Y43H probably benign Het
Vmn1r25 T A 6: 57,978,564 I247F probably damaging Het
Vmn2r78 A T 7: 86,921,135 Q287L probably benign Het
Vps13c T A 9: 67,963,089 I3170N probably benign Het
Zfc3h1 T A 10: 115,400,815 M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp773 T C 7: 7,132,908 R230G probably benign Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 181229702 missense probably damaging 1.00
IGL00515:Helz2 APN 2 181233006 nonsense probably null
IGL00704:Helz2 APN 2 181234385 missense probably damaging 1.00
IGL00847:Helz2 APN 2 181232245 missense possibly damaging 0.73
IGL01448:Helz2 APN 2 181233977 missense probably damaging 1.00
IGL01783:Helz2 APN 2 181232881 missense probably damaging 1.00
IGL01790:Helz2 APN 2 181238481 missense probably benign 0.29
IGL02116:Helz2 APN 2 181232185 missense probably damaging 1.00
IGL02226:Helz2 APN 2 181231690 missense probably damaging 1.00
IGL02402:Helz2 APN 2 181230911 missense probably damaging 1.00
IGL02403:Helz2 APN 2 181231022 missense probably damaging 1.00
IGL02733:Helz2 APN 2 181235026 missense probably benign 0.14
IGL02869:Helz2 APN 2 181231146 intron probably benign
IGL03003:Helz2 APN 2 181240253 missense probably damaging 1.00
IGL03060:Helz2 APN 2 181229222 critical splice donor site probably null
IGL03310:Helz2 APN 2 181231804 missense probably benign 0.00
Colby UTSW 2 181233202 missense probably damaging 1.00
ANU74:Helz2 UTSW 2 181234834 missense probably benign 0.03
R0013:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0013:Helz2 UTSW 2 181240959 missense probably benign
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0016:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0018:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0111:Helz2 UTSW 2 181237802 missense probably benign 0.30
R0117:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0135:Helz2 UTSW 2 181232269 missense probably damaging 1.00
R0194:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0254:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0410:Helz2 UTSW 2 181230593 missense probably damaging 1.00
R0442:Helz2 UTSW 2 181232209 missense probably damaging 0.97
R0497:Helz2 UTSW 2 181229656 missense probably damaging 0.97
R0517:Helz2 UTSW 2 181227770 missense probably benign 0.00
R0541:Helz2 UTSW 2 181234825 missense possibly damaging 0.89
R0542:Helz2 UTSW 2 181232089 missense probably damaging 1.00
R0591:Helz2 UTSW 2 181232116 missense probably damaging 0.96
R0692:Helz2 UTSW 2 181240881 missense probably benign
R0826:Helz2 UTSW 2 181240853 missense possibly damaging 0.51
R0834:Helz2 UTSW 2 181230777 missense probably damaging 1.00
R0880:Helz2 UTSW 2 181236135 missense probably benign
R1170:Helz2 UTSW 2 181229815 missense probably damaging 1.00
R1186:Helz2 UTSW 2 181231128 missense probably damaging 1.00
R1344:Helz2 UTSW 2 181237596 missense possibly damaging 0.89
R1358:Helz2 UTSW 2 181232981 missense probably damaging 1.00
R1436:Helz2 UTSW 2 181235524 missense probably damaging 0.99
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1477:Helz2 UTSW 2 181232804 missense probably benign 0.00
R1564:Helz2 UTSW 2 181233228 missense probably benign 0.01
R1584:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1655:Helz2 UTSW 2 181234147 missense probably damaging 0.99
R1757:Helz2 UTSW 2 181236263 missense probably damaging 1.00
R1779:Helz2 UTSW 2 181234987 missense probably benign
R1779:Helz2 UTSW 2 181238459 missense possibly damaging 0.84
R1837:Helz2 UTSW 2 181229289 missense probably damaging 1.00
R1845:Helz2 UTSW 2 181232085 missense probably benign 0.02
R1894:Helz2 UTSW 2 181234289 missense probably damaging 1.00
R1913:Helz2 UTSW 2 181233750 missense probably damaging 1.00
R2005:Helz2 UTSW 2 181231329 missense probably benign 0.45
R2034:Helz2 UTSW 2 181232578 missense probably damaging 1.00
R2036:Helz2 UTSW 2 181237479 missense probably benign 0.03
R2061:Helz2 UTSW 2 181240544 missense probably damaging 1.00
R2088:Helz2 UTSW 2 181235102 missense probably benign 0.07
R2142:Helz2 UTSW 2 181231380 missense probably benign
R2180:Helz2 UTSW 2 181233732 missense probably damaging 1.00
R2192:Helz2 UTSW 2 181229048 nonsense probably null
R2248:Helz2 UTSW 2 181233433 missense probably benign 0.33
R2495:Helz2 UTSW 2 181232912 missense probably damaging 0.99
R2886:Helz2 UTSW 2 181240742 missense probably benign
R3617:Helz2 UTSW 2 181233061 missense probably damaging 1.00
R3776:Helz2 UTSW 2 181240389 nonsense probably null
R3803:Helz2 UTSW 2 181239996 missense probably damaging 0.96
R4043:Helz2 UTSW 2 181229710 missense probably benign 0.00
R4052:Helz2 UTSW 2 181240475 missense probably damaging 1.00
R4232:Helz2 UTSW 2 181229902 missense probably damaging 1.00
R4521:Helz2 UTSW 2 181228833 missense probably benign
R4624:Helz2 UTSW 2 181239308 missense probably damaging 0.99
R4720:Helz2 UTSW 2 181238417 missense probably damaging 1.00
R4831:Helz2 UTSW 2 181237417 missense probably damaging 1.00
R4852:Helz2 UTSW 2 181230120 missense probably damaging 1.00
R4894:Helz2 UTSW 2 181236147 missense probably benign 0.01
R4915:Helz2 UTSW 2 181232438 missense possibly damaging 0.80
R4965:Helz2 UTSW 2 181240916 missense possibly damaging 0.79
R5022:Helz2 UTSW 2 181240569 missense probably benign
R5089:Helz2 UTSW 2 181235149 missense probably benign 0.14
R5190:Helz2 UTSW 2 181230757 critical splice donor site probably null
R5309:Helz2 UTSW 2 181234846 missense probably benign 0.08
R5358:Helz2 UTSW 2 181235528 missense probably damaging 1.00
R5379:Helz2 UTSW 2 181235069 missense probably benign
R5559:Helz2 UTSW 2 181230126 missense probably damaging 0.98
R5591:Helz2 UTSW 2 181240258 missense probably damaging 0.99
R5596:Helz2 UTSW 2 181237289 intron probably benign
R5805:Helz2 UTSW 2 181240508 missense probably damaging 1.00
R5823:Helz2 UTSW 2 181236396 missense possibly damaging 0.92
R5825:Helz2 UTSW 2 181232656 missense probably benign 0.02
R5873:Helz2 UTSW 2 181234028 missense possibly damaging 0.78
R5928:Helz2 UTSW 2 181230384 missense possibly damaging 0.82
R5936:Helz2 UTSW 2 181230767 missense probably damaging 1.00
R5975:Helz2 UTSW 2 181231050 missense probably benign 0.08
R6045:Helz2 UTSW 2 181240313 missense probably benign 0.03
R6077:Helz2 UTSW 2 181233038 missense probably benign 0.41
R6218:Helz2 UTSW 2 181232294 missense probably benign 0.03
R6218:Helz2 UTSW 2 181235945 missense probably damaging 1.00
R6315:Helz2 UTSW 2 181233202 missense probably damaging 1.00
R6346:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6371:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6372:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6373:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6385:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6464:Helz2 UTSW 2 181235069 missense probably benign
R6581:Helz2 UTSW 2 181229379 missense probably damaging 0.99
R6651:Helz2 UTSW 2 181239557 nonsense probably null
R6964:Helz2 UTSW 2 181230428 missense probably damaging 1.00
R7061:Helz2 UTSW 2 181240514 missense probably damaging 1.00
R7153:Helz2 UTSW 2 181231285 missense probably benign 0.00
R7372:Helz2 UTSW 2 181238423 missense possibly damaging 0.61
R7512:Helz2 UTSW 2 181230854 missense probably benign 0.00
R7512:Helz2 UTSW 2 181235600 splice site probably null
R7583:Helz2 UTSW 2 181237572 missense probably benign 0.06
R7724:Helz2 UTSW 2 181231996 missense probably damaging 1.00
R7733:Helz2 UTSW 2 181230355 missense possibly damaging 0.63
R7774:Helz2 UTSW 2 181233991 missense probably benign
R7799:Helz2 UTSW 2 181237989 missense probably benign 0.15
R7841:Helz2 UTSW 2 181232902 missense probably damaging 1.00
R7939:Helz2 UTSW 2 181237750 missense probably damaging 0.99
R8026:Helz2 UTSW 2 181240205 missense probably benign 0.34
R8030:Helz2 UTSW 2 181237896 missense possibly damaging 0.55
R8080:Helz2 UTSW 2 181238262 missense probably damaging 0.99
R8237:Helz2 UTSW 2 181229331 missense possibly damaging 0.65
R8245:Helz2 UTSW 2 181238102 missense probably damaging 1.00
R8304:Helz2 UTSW 2 181230157 missense probably benign 0.03
R8486:Helz2 UTSW 2 181229331 missense probably damaging 1.00
R8556:Helz2 UTSW 2 181229557 missense probably damaging 1.00
X0064:Helz2 UTSW 2 181231741 missense probably damaging 1.00
Z1176:Helz2 UTSW 2 181237564 missense probably benign 0.39
Z1177:Helz2 UTSW 2 181235961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGTCACAGAACCGTTGATAGG -3'
(R):5'- TTCTGGACACCGTGGTTTGC -3'

Sequencing Primer
(F):5'- ACCGTTGATAGGGATCATGATGC -3'
(R):5'- GACACCGTGGTTTGCTCTGC -3'
Posted On2019-11-26