Mutagenetix > Incidental Mutation

Incidental Mutation 'R7748:Notch2'

596971

Institutional Source

Beutler Lab

Gene Symbol

Notch2

Ensembl Gene

ENSMUSG00000027878

Gene Name

notch 2

Synonyms

N2, Motch B

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7748 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98013527-98150361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98138484 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1655 (H1655R)

Ref Sequence

ENSEMBL: ENSMUSP00000078741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079812]

AlphaFold

O35516

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079812
AA Change: H1655R

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878
AA Change: H1655R

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	27	63	5.79e-2	SMART
EGF	67	102	1.54e-6	SMART
EGF	108	143	6.25e-7	SMART
EGF	147	180	5.28e-5	SMART
EGF_CA	182	219	6.14e-15	SMART
EGF	224	258	5.08e-7	SMART
EGF_CA	260	296	1.95e-8	SMART
EGF_CA	298	336	3.91e-8	SMART
EGF_CA	338	374	7.69e-7	SMART
EGF	378	413	6.86e-4	SMART
EGF_CA	415	454	4.15e-12	SMART
EGF_CA	456	492	3.24e-14	SMART
EGF_CA	494	530	4.77e-12	SMART
EGF_CA	532	568	2.04e-11	SMART
EGF_CA	570	605	1.18e-7	SMART
EGF_CA	607	643	7.12e-11	SMART
EGF_CA	645	680	1.82e-8	SMART
EGF_CA	682	718	1.42e-10	SMART
EGF_CA	720	755	1.25e-6	SMART
EGF_CA	757	793	3.61e-12	SMART
EGF_CA	795	831	1.53e-10	SMART
EGF	836	871	1.34e-6	SMART
EGF_CA	873	909	6.05e-14	SMART
EGF_CA	911	947	9.54e-12	SMART
EGF_CA	949	985	1.39e-13	SMART
EGF_CA	987	1023	1.26e-11	SMART
EGF_CA	1025	1061	9.31e-15	SMART
EGF	1066	1099	1.39e-4	SMART
EGF	1104	1147	2.6e-4	SMART
EGF_CA	1149	1185	1.55e-11	SMART
EGF_CA	1187	1223	2.74e-12	SMART
EGF_CA	1225	1262	4.15e-12	SMART
EGF	1267	1302	1.43e-1	SMART
EGF	1307	1343	2.33e-6	SMART
EGF	1377	1412	9.85e-5	SMART
NL	1418	1456	8.55e-19	SMART
NL	1459	1497	2.27e-14	SMART
NL	1498	1535	1.16e-11	SMART
NOD	1539	1595	3.4e-28	SMART
NODP	1619	1679	1.66e-22	SMART
transmembrane domain	1680	1702	N/A	INTRINSIC
ANK	1828	1872	2.18e2	SMART
ANK	1877	1906	3.36e-2	SMART
ANK	1910	1940	1.81e2	SMART
ANK	1944	1973	6.61e-1	SMART
ANK	1977	2006	5.24e-4	SMART
ANK	2010	2039	3.41e-3	SMART
low complexity region	2179	2193	N/A	INTRINSIC
low complexity region	2232	2241	N/A	INTRINSIC
DUF3454	2382	2447	4.62e-30	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in embryonic or neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	T	A	7: 131,361,792	L103F	probably benign	Het
4932438A13Rik	A	G	3: 36,959,335		probably null	Het
5330417H12Rik	A	G	7: 107,624,558	L103P	unknown	Het
Actb	T	C	5: 142,904,695	I151V	probably benign	Het
Adcy6	T	A	15: 98,604,556	H59L	probably benign	Het
Adss	G	C	1: 177,772,202	S272*	probably null	Het
Aga	A	T	8: 53,511,805	M1L	possibly damaging	Het
Anxa5	G	A	3: 36,465,331	T3M	probably damaging	Het
Arhgap45	A	T	10: 80,016,932		probably benign	Het
Atp6v0a2	A	T	5: 124,716,496	H639L	probably benign	Het
BC005537	C	T	13: 24,803,399	R7W	possibly damaging	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bod1l	A	C	5: 41,832,340	S347A	probably damaging	Het
Calcoco1	T	C	15: 102,719,561	D46G	probably damaging	Het
Camk1	T	C	6: 113,340,328	E60G	probably damaging	Het
Capza1	A	T	3: 104,825,405		probably null	Het
Ccdc18	T	A	5: 108,149,041		probably null	Het
Cdh20	G	A	1: 104,941,299	A172T	probably damaging	Het
Cdk4	C	T	10: 127,064,429	A65V	possibly damaging	Het
Cftr	T	C	6: 18,277,889		probably null	Het
Chd3	T	C	11: 69,355,633	M1092V	probably benign	Het
Chd6	A	T	2: 160,966,619	H1558Q	probably benign	Het
Chil1	A	G	1: 134,189,228	H318R	probably benign	Het
Cps1	A	G	1: 67,139,806	Y59C	probably damaging	Het
Cyb5r4	T	C	9: 87,032,381	V111A	probably damaging	Het
D430042O09Rik	A	T	7: 125,829,801	M558L	probably benign	Het
Ddx39b	G	A	17: 35,252,750	V291M	probably damaging	Het
Dhx57	A	G	17: 80,265,117	F709S	probably damaging	Het
Eef1b2	A	T	1: 63,177,865	K64N	probably damaging	Het
Fam135a	A	G	1: 24,028,969	S940P	probably benign	Het
Fam234b	T	A	6: 135,209,351	V119E	probably damaging	Het
Fbxo46	G	C	7: 19,136,533	C359S	probably damaging	Het
Fkbp14	C	A	6: 54,595,520		probably benign	Het
Fmn2	T	A	1: 174,666,649	V1243E	probably damaging	Het
Fsbp	C	A	4: 11,579,924	T64K	probably damaging	Het
Fscb	A	T	12: 64,474,407	M95K	probably benign	Het
Fyb	T	G	15: 6,638,826	V500G	probably damaging	Het
G2e3	A	G	12: 51,371,667	N615S	probably benign	Het
Gart	T	C	16: 91,630,652	D486G	possibly damaging	Het
Gas2l2	T	A	11: 83,422,398	D696V	probably benign	Het
Glmn	C	T	5: 107,562,244		probably null	Het
Gm47985	A	T	1: 151,182,974	D122V	probably damaging	Het
Gm49333	A	T	16: 20,633,084	D407V	probably damaging	Het
Gm7168	A	G	17: 13,948,652	K94E	probably benign	Het
Gm996	T	A	2: 25,578,959	E313D	possibly damaging	Het
Gnai2	T	C	9: 107,615,735	H323R		Het
Helz2	C	T	2: 181,234,531	R1390H	probably damaging	Het
Igf2bp1	T	C	11: 95,967,587	M453V	probably benign	Het
Ighv3-1	C	T	12: 113,964,650	V30M	probably damaging	Het
Inpp5a	A	T	7: 139,574,995	R343S	probably damaging	Het
Itga8	T	A	2: 12,230,239	I403F	possibly damaging	Het
Krt33a	C	T	11: 100,011,602	R404H	probably benign	Het
Krt34	T	A	11: 100,038,938	E244V	probably damaging	Het
Krt42	T	C	11: 100,266,966	E224G	probably damaging	Het
Krtap5-2	TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA	TCCACAGGAACTACA	7: 142,175,108		probably benign	Het
Lama1	T	C	17: 67,750,590	L553P		Het
Lcn9	T	A	2: 25,824,914	*179K	probably null	Het
Lrrc2	T	G	9: 110,980,931	M345R	possibly damaging	Het
March11	T	C	15: 26,387,830	V257A	probably damaging	Het
Masp2	T	C	4: 148,605,706	I224T	probably benign	Het
Mpz	A	T	1: 171,159,940		probably null	Het
Mtr	C	T	13: 12,227,839	A442T	probably benign	Het
Muc5b	A	G	7: 141,847,805	K596R	unknown	Het
Myo15	T	G	11: 60,504,901	F1397C		Het
Ncor2	T	C	5: 125,109,967	I173V	unknown	Het
Ngly1	T	A	14: 16,290,820	I434K	possibly damaging	Het
Notum	C	T	11: 120,654,801	A390T	probably damaging	Het
Olfr381	T	G	11: 73,486,168	I219L	probably benign	Het
Olfr519	T	C	7: 108,894,078	T115A	probably benign	Het
Pds5a	T	A	5: 65,619,666	I51F	possibly damaging	Het
Pdzd2	C	A	15: 12,385,786	R966L	possibly damaging	Het
Plk3	T	C	4: 117,131,728	Y278C	probably damaging	Het
Plxna1	C	G	6: 89,337,352		probably null	Het
Plxna1	T	A	6: 89,337,353		probably null	Het
Ppp4r4	G	A	12: 103,605,061		probably null	Het
Pramel6	T	A	2: 87,508,699	V81E	probably damaging	Het
Prdm2	T	C	4: 143,135,889	E277G	possibly damaging	Het
Prkg1	T	A	19: 30,993,091	I222F	possibly damaging	Het
Proser3	A	T	7: 30,540,072	S536T	possibly damaging	Het
Prrt4	C	A	6: 29,177,191	G193V	probably damaging	Het
Ptpn21	A	T	12: 98,688,772	H645Q	probably benign	Het
Ptprd	T	C	4: 76,099,504	I744V	probably null	Het
Rad54l2	A	G	9: 106,719,034	V235A	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rgs22	C	T	15: 36,122,269		probably null	Het
Rtcb	A	T	10: 85,941,968	D447E	probably benign	Het
Rtn1	C	T	12: 72,216,926	V744I	possibly damaging	Het
Scfd1	T	G	12: 51,389,357	I96M	probably benign	Het
Serpina3b	T	C	12: 104,130,463	M1T	probably null	Het
Slc1a4	T	C	11: 20,332,252	Y74C	probably damaging	Het
Slc9b2	A	T	3: 135,326,179	I267F	possibly damaging	Het
Sorcs2	A	T	5: 36,229,175	M173K	possibly damaging	Het
Sparc	T	C	11: 55,398,600	I226V	probably benign	Het
Spata22	T	G	11: 73,336,254	I98S	probably null	Het
Spef2	C	T	15: 9,652,945	V917M	probably damaging	Het
Sspo	C	A	6: 48,449,465	C139*	probably null	Het
Tenm4	A	G	7: 96,894,702	D2012G	probably damaging	Het
Tgm5	G	A	2: 121,052,808	R351C	probably damaging	Het
Tmem145	G	A	7: 25,307,328	W82*	probably null	Het
Tmem159	A	T	7: 120,115,479	I64F	possibly damaging	Het
Topors	T	A	4: 40,262,654	D210V	probably damaging	Het
Tssk4	A	T	14: 55,651,112	H146L	probably damaging	Het
Unc93b1	T	A	19: 3,935,250	D19E	unknown	Het
Usp17lc	A	G	7: 103,418,481	T328A	probably damaging	Het
Utrn	A	G	10: 12,614,508	Y43H	probably benign	Het
Vmn1r25	T	A	6: 57,978,564	I247F	probably damaging	Het
Vmn2r78	A	T	7: 86,921,135	Q287L	probably benign	Het
Vps13c	T	A	9: 67,963,089	I3170N	probably benign	Het
Zfc3h1	T	A	10: 115,400,815	M398K	probably benign	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp773	T	C	7: 7,132,908	R230G	probably benign	Het

Other mutations in Notch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Notch2	APN	3	98111675	missense	possibly damaging	0.77
IGL01517:Notch2	APN	3	98138655	missense	probably benign	0.16
IGL01630:Notch2	APN	3	98146618	missense	possibly damaging	0.77
IGL01637:Notch2	APN	3	98146060	missense	probably damaging	1.00
IGL01828:Notch2	APN	3	98072613	missense	probably damaging	1.00
IGL01998:Notch2	APN	3	98143106	missense	probably damaging	1.00
IGL02008:Notch2	APN	3	98147296	missense	probably damaging	1.00
IGL02030:Notch2	APN	3	98099421	splice site	probably null
IGL02155:Notch2	APN	3	98138490	missense	probably damaging	0.98
IGL02268:Notch2	APN	3	98137397	missense	probably damaging	1.00
IGL02301:Notch2	APN	3	98141554	missense	probably benign	0.08
IGL02336:Notch2	APN	3	98138395	missense	possibly damaging	0.73
IGL02340:Notch2	APN	3	98147336	nonsense	probably null
IGL02536:Notch2	APN	3	98102407	missense	probably benign	0.03
IGL02589:Notch2	APN	3	98104347	critical splice acceptor site	probably null
IGL02633:Notch2	APN	3	98116697	splice site	probably benign
IGL02691:Notch2	APN	3	98135607	nonsense	probably null
IGL02832:Notch2	APN	3	98137373	missense	probably benign	0.12
IGL02894:Notch2	APN	3	98102432	nonsense	probably null
IGL02902:Notch2	APN	3	98111574	missense	probably damaging	1.00
IGL02967:Notch2	APN	3	98146144	missense	probably damaging	0.99
IGL03015:Notch2	APN	3	98072649	missense	possibly damaging	0.83
PIT4378001:Notch2	UTSW	3	98142956	missense	probably damaging	1.00
PIT4519001:Notch2	UTSW	3	98098108	missense	probably damaging	1.00
PIT4581001:Notch2	UTSW	3	98104462	missense	probably damaging	1.00
R0111:Notch2	UTSW	3	98138761	missense	probably benign	0.00
R0129:Notch2	UTSW	3	98146620	missense	probably benign	0.08
R0143:Notch2	UTSW	3	98146117	missense	probably damaging	0.99
R0480:Notch2	UTSW	3	98146537	missense	possibly damaging	0.88
R0523:Notch2	UTSW	3	98070970	missense	probably benign	0.34
R0523:Notch2	UTSW	3	98111598	missense	probably benign	0.00
R0531:Notch2	UTSW	3	98102451	splice site	probably benign
R0537:Notch2	UTSW	3	98116741	missense	possibly damaging	0.70
R0987:Notch2	UTSW	3	98134677	splice site	probably null
R1485:Notch2	UTSW	3	98100257	missense	probably benign	0.00
R1555:Notch2	UTSW	3	98131340	missense	possibly damaging	0.93
R1625:Notch2	UTSW	3	98111575	missense	probably damaging	1.00
R1699:Notch2	UTSW	3	98145127	missense	probably damaging	1.00
R1765:Notch2	UTSW	3	98121926	missense	probably damaging	1.00
R1794:Notch2	UTSW	3	98099547	missense	possibly damaging	0.53
R1974:Notch2	UTSW	3	98072755	missense	probably damaging	1.00
R2086:Notch2	UTSW	3	98102367	missense	probably damaging	1.00
R2099:Notch2	UTSW	3	98115321	missense	possibly damaging	0.79
R3778:Notch2	UTSW	3	98146623	missense	probably damaging	1.00
R3924:Notch2	UTSW	3	98122034	nonsense	probably null
R4018:Notch2	UTSW	3	98104565	missense	probably damaging	1.00
R4151:Notch2	UTSW	3	98147071	missense	possibly damaging	0.95
R4417:Notch2	UTSW	3	98131270	missense	possibly damaging	0.95
R4510:Notch2	UTSW	3	98146321	missense	probably benign	0.02
R4511:Notch2	UTSW	3	98146321	missense	probably benign	0.02
R4636:Notch2	UTSW	3	98146104	missense	probably benign	0.02
R4661:Notch2	UTSW	3	98135513	missense	probably damaging	1.00
R4856:Notch2	UTSW	3	98102419	missense	probably damaging	1.00
R4886:Notch2	UTSW	3	98102419	missense	probably damaging	1.00
R4945:Notch2	UTSW	3	98111721	missense	probably benign	0.01
R4970:Notch2	UTSW	3	98101636	critical splice donor site	probably null
R4974:Notch2	UTSW	3	98139633	missense	probably benign	0.39
R5082:Notch2	UTSW	3	98100374	missense	probably damaging	1.00
R5112:Notch2	UTSW	3	98101636	critical splice donor site	probably null
R5156:Notch2	UTSW	3	98124310	missense	possibly damaging	0.53
R5433:Notch2	UTSW	3	98126134	missense	probably damaging	1.00
R5539:Notch2	UTSW	3	98137582	missense	probably damaging	0.99
R5813:Notch2	UTSW	3	98135428	missense	probably benign
R5827:Notch2	UTSW	3	98072862	missense	possibly damaging	0.64
R5908:Notch2	UTSW	3	98123923	intron	probably benign
R6021:Notch2	UTSW	3	98121972	missense	probably damaging	1.00
R6090:Notch2	UTSW	3	98135377	nonsense	probably null
R6103:Notch2	UTSW	3	98135743	missense	possibly damaging	0.94
R6111:Notch2	UTSW	3	98146293	missense	probably benign	0.00
R6168:Notch2	UTSW	3	98145217	missense	probably damaging	1.00
R6382:Notch2	UTSW	3	98141543	missense	probably damaging	1.00
R6404:Notch2	UTSW	3	98081998	missense	probably damaging	1.00
R6419:Notch2	UTSW	3	98100389	critical splice donor site	probably null
R6454:Notch2	UTSW	3	98137406	missense	possibly damaging	0.47
R6626:Notch2	UTSW	3	98101605	missense	probably damaging	1.00
R6629:Notch2	UTSW	3	98120881	missense	possibly damaging	0.65
R6706:Notch2	UTSW	3	98138430	missense	possibly damaging	0.94
R6735:Notch2	UTSW	3	98134586	missense	probably damaging	1.00
R6837:Notch2	UTSW	3	98070854	splice site	probably null
R7021:Notch2	UTSW	3	98135446	missense	probably benign
R7028:Notch2	UTSW	3	98102387	missense	probably damaging	1.00
R7228:Notch2	UTSW	3	98137317	nonsense	probably null
R7320:Notch2	UTSW	3	98131327	missense	possibly damaging	0.94
R7361:Notch2	UTSW	3	98131402	missense	probably benign	0.04
R7562:Notch2	UTSW	3	98113114	missense	probably damaging	1.00
R7630:Notch2	UTSW	3	98137508	missense	possibly damaging	0.65
R7637:Notch2	UTSW	3	98146623	missense	probably damaging	1.00
R7764:Notch2	UTSW	3	98142988	missense	probably damaging	1.00
R7817:Notch2	UTSW	3	98107127	missense	probably damaging	1.00
R7952:Notch2	UTSW	3	98100236	missense	probably benign	0.30
R8136:Notch2	UTSW	3	98124221	missense	probably damaging	1.00
R8159:Notch2	UTSW	3	98120922	missense	possibly damaging	0.95
R8679:Notch2	UTSW	3	98121902	critical splice acceptor site	probably null
R8879:Notch2	UTSW	3	98135599	missense	possibly damaging	0.73
R9146:Notch2	UTSW	3	98104538	missense	probably damaging	1.00
R9398:Notch2	UTSW	3	98102352	missense	probably damaging	1.00
R9422:Notch2	UTSW	3	98147352	missense	probably damaging	1.00
R9594:Notch2	UTSW	3	98134573	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- TCAGCATCTGAAGCATCCTG -3'
(R):5'- GACTCTCCAGTTCACCTGAGAG -3'

Sequencing Primer
(F):5'- CGAAGGTGGAAAGCTTGATGC -3'
(R):5'- GTTCAGACATAGGGACAGTGATG -3'

Posted On

2019-11-26