Mutagenetix > Incidental Mutation

Incidental Mutation 'R7748:Masp2'

596979

Institutional Source

Beutler Lab

Gene Symbol

Masp2

Ensembl Gene

ENSMUSG00000028979

Gene Name

mannan-binding lectin serine peptidase 2

Synonyms

MASP-2, MAp19

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.207) question?

Stock #

R7748 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

148602554-148615499 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 148605706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 224 (I224T)

Ref Sequence

ENSEMBL: ENSMUSP00000049729 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052060] [ENSMUST00000105701]

AlphaFold

Q91WP0

Predicted Effect

probably benign
Transcript: ENSMUST00000052060
AA Change: I224T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000049729
Gene: ENSMUSG00000028979
AA Change: I224T

Domain	Start	End	E-Value	Type
CUB	18	137	4.71e-30	SMART
EGF_CA	138	181	4.32e-10	SMART
CUB	184	296	4.29e-33	SMART
CCP	300	361	1.79e-12	SMART
CCP	366	429	5.4e-7	SMART
Tryp_SPc	443	678	1.3e-82	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105701

SMART Domains

Protein: ENSMUSP00000101326
Gene: ENSMUSG00000028979

Domain	Start	End	E-Value	Type
CUB	18	137	4.71e-30	SMART
EGF_CA	138	181	4.32e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous disruption of the exon encoding the small mannose-binding lectin (MBL)-associated protein results in a defective lectin-mediated complement pathway with a 20% reduction in the ability of serum components to cleave C3 and C4 in the presence of mannose. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	T	A	7: 131,361,792	L103F	probably benign	Het
4932438A13Rik	A	G	3: 36,959,335		probably null	Het
5330417H12Rik	A	G	7: 107,624,558	L103P	unknown	Het
Actb	T	C	5: 142,904,695	I151V	probably benign	Het
Adcy6	T	A	15: 98,604,556	H59L	probably benign	Het
Adss	G	C	1: 177,772,202	S272*	probably null	Het
Aga	A	T	8: 53,511,805	M1L	possibly damaging	Het
Anxa5	G	A	3: 36,465,331	T3M	probably damaging	Het
Arhgap45	A	T	10: 80,016,932		probably benign	Het
Atp6v0a2	A	T	5: 124,716,496	H639L	probably benign	Het
BC005537	C	T	13: 24,803,399	R7W	possibly damaging	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bod1l	A	C	5: 41,832,340	S347A	probably damaging	Het
Calcoco1	T	C	15: 102,719,561	D46G	probably damaging	Het
Camk1	T	C	6: 113,340,328	E60G	probably damaging	Het
Capza1	A	T	3: 104,825,405		probably null	Het
Ccdc18	T	A	5: 108,149,041		probably null	Het
Cdh20	G	A	1: 104,941,299	A172T	probably damaging	Het
Cdk4	C	T	10: 127,064,429	A65V	possibly damaging	Het
Cftr	T	C	6: 18,277,889		probably null	Het
Chd3	T	C	11: 69,355,633	M1092V	probably benign	Het
Chd6	A	T	2: 160,966,619	H1558Q	probably benign	Het
Chil1	A	G	1: 134,189,228	H318R	probably benign	Het
Cps1	A	G	1: 67,139,806	Y59C	probably damaging	Het
Cyb5r4	T	C	9: 87,032,381	V111A	probably damaging	Het
D430042O09Rik	A	T	7: 125,829,801	M558L	probably benign	Het
Ddx39b	G	A	17: 35,252,750	V291M	probably damaging	Het
Dhx57	A	G	17: 80,265,117	F709S	probably damaging	Het
Eef1b2	A	T	1: 63,177,865	K64N	probably damaging	Het
Fam135a	A	G	1: 24,028,969	S940P	probably benign	Het
Fam234b	T	A	6: 135,209,351	V119E	probably damaging	Het
Fbxo46	G	C	7: 19,136,533	C359S	probably damaging	Het
Fkbp14	C	A	6: 54,595,520		probably benign	Het
Fmn2	T	A	1: 174,666,649	V1243E	probably damaging	Het
Fsbp	C	A	4: 11,579,924	T64K	probably damaging	Het
Fscb	A	T	12: 64,474,407	M95K	probably benign	Het
Fyb	T	G	15: 6,638,826	V500G	probably damaging	Het
G2e3	A	G	12: 51,371,667	N615S	probably benign	Het
Gart	T	C	16: 91,630,652	D486G	possibly damaging	Het
Gas2l2	T	A	11: 83,422,398	D696V	probably benign	Het
Glmn	C	T	5: 107,562,244		probably null	Het
Gm47985	A	T	1: 151,182,974	D122V	probably damaging	Het
Gm49333	A	T	16: 20,633,084	D407V	probably damaging	Het
Gm7168	A	G	17: 13,948,652	K94E	probably benign	Het
Gm996	T	A	2: 25,578,959	E313D	possibly damaging	Het
Gnai2	T	C	9: 107,615,735	H323R		Het
Helz2	C	T	2: 181,234,531	R1390H	probably damaging	Het
Igf2bp1	T	C	11: 95,967,587	M453V	probably benign	Het
Ighv3-1	C	T	12: 113,964,650	V30M	probably damaging	Het
Inpp5a	A	T	7: 139,574,995	R343S	probably damaging	Het
Itga8	T	A	2: 12,230,239	I403F	possibly damaging	Het
Krt33a	C	T	11: 100,011,602	R404H	probably benign	Het
Krt34	T	A	11: 100,038,938	E244V	probably damaging	Het
Krt42	T	C	11: 100,266,966	E224G	probably damaging	Het
Krtap5-2	TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA	TCCACAGGAACTACA	7: 142,175,108		probably benign	Het
Lama1	T	C	17: 67,750,590	L553P		Het
Lcn9	T	A	2: 25,824,914	*179K	probably null	Het
Lrrc2	T	G	9: 110,980,931	M345R	possibly damaging	Het
March11	T	C	15: 26,387,830	V257A	probably damaging	Het
Mpz	A	T	1: 171,159,940		probably null	Het
Mtr	C	T	13: 12,227,839	A442T	probably benign	Het
Muc5b	A	G	7: 141,847,805	K596R	unknown	Het
Myo15	T	G	11: 60,504,901	F1397C		Het
Ncor2	T	C	5: 125,109,967	I173V	unknown	Het
Ngly1	T	A	14: 16,290,820	I434K	possibly damaging	Het
Notch2	A	G	3: 98,138,484	H1655R	possibly damaging	Het
Notum	C	T	11: 120,654,801	A390T	probably damaging	Het
Olfr381	T	G	11: 73,486,168	I219L	probably benign	Het
Olfr519	T	C	7: 108,894,078	T115A	probably benign	Het
Pds5a	T	A	5: 65,619,666	I51F	possibly damaging	Het
Pdzd2	C	A	15: 12,385,786	R966L	possibly damaging	Het
Plk3	T	C	4: 117,131,728	Y278C	probably damaging	Het
Plxna1	C	G	6: 89,337,352		probably null	Het
Plxna1	T	A	6: 89,337,353		probably null	Het
Ppp4r4	G	A	12: 103,605,061		probably null	Het
Pramel6	T	A	2: 87,508,699	V81E	probably damaging	Het
Prdm2	T	C	4: 143,135,889	E277G	possibly damaging	Het
Prkg1	T	A	19: 30,993,091	I222F	possibly damaging	Het
Proser3	A	T	7: 30,540,072	S536T	possibly damaging	Het
Prrt4	C	A	6: 29,177,191	G193V	probably damaging	Het
Ptpn21	A	T	12: 98,688,772	H645Q	probably benign	Het
Ptprd	T	C	4: 76,099,504	I744V	probably null	Het
Rad54l2	A	G	9: 106,719,034	V235A	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rgs22	C	T	15: 36,122,269		probably null	Het
Rtcb	A	T	10: 85,941,968	D447E	probably benign	Het
Rtn1	C	T	12: 72,216,926	V744I	possibly damaging	Het
Scfd1	T	G	12: 51,389,357	I96M	probably benign	Het
Serpina3b	T	C	12: 104,130,463	M1T	probably null	Het
Slc1a4	T	C	11: 20,332,252	Y74C	probably damaging	Het
Slc9b2	A	T	3: 135,326,179	I267F	possibly damaging	Het
Sorcs2	A	T	5: 36,229,175	M173K	possibly damaging	Het
Sparc	T	C	11: 55,398,600	I226V	probably benign	Het
Spata22	T	G	11: 73,336,254	I98S	probably null	Het
Spef2	C	T	15: 9,652,945	V917M	probably damaging	Het
Sspo	C	A	6: 48,449,465	C139*	probably null	Het
Tenm4	A	G	7: 96,894,702	D2012G	probably damaging	Het
Tgm5	G	A	2: 121,052,808	R351C	probably damaging	Het
Tmem145	G	A	7: 25,307,328	W82*	probably null	Het
Tmem159	A	T	7: 120,115,479	I64F	possibly damaging	Het
Topors	T	A	4: 40,262,654	D210V	probably damaging	Het
Tssk4	A	T	14: 55,651,112	H146L	probably damaging	Het
Unc93b1	T	A	19: 3,935,250	D19E	unknown	Het
Usp17lc	A	G	7: 103,418,481	T328A	probably damaging	Het
Utrn	A	G	10: 12,614,508	Y43H	probably benign	Het
Vmn1r25	T	A	6: 57,978,564	I247F	probably damaging	Het
Vmn2r78	A	T	7: 86,921,135	Q287L	probably benign	Het
Vps13c	T	A	9: 67,963,089	I3170N	probably benign	Het
Zfc3h1	T	A	10: 115,400,815	M398K	probably benign	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp773	T	C	7: 7,132,908	R230G	probably benign	Het

Other mutations in Masp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00592:Masp2	APN	4	148602729	missense	probably benign	0.05
IGL01284:Masp2	APN	4	148614007	missense	probably damaging	1.00
IGL02040:Masp2	APN	4	148603813	missense	probably damaging	1.00
IGL02243:Masp2	APN	4	148603068	missense	probably benign	0.32
IGL02490:Masp2	APN	4	148607943	missense	possibly damaging	0.91
IGL02517:Masp2	APN	4	148614020	missense	probably damaging	1.00
IGL02997:Masp2	APN	4	148603175	splice site	probably benign
R0408:Masp2	UTSW	4	148606039	missense	probably benign
R1517:Masp2	UTSW	4	148612106	missense	possibly damaging	0.74
R1630:Masp2	UTSW	4	148614033	missense	probably benign	0.07
R1634:Masp2	UTSW	4	148614355	missense	probably damaging	1.00
R1873:Masp2	UTSW	4	148614495	missense	probably damaging	1.00
R2208:Masp2	UTSW	4	148614415	missense	probably damaging	1.00
R2283:Masp2	UTSW	4	148606068	missense	probably benign	0.00
R2876:Masp2	UTSW	4	148608001	missense	probably benign
R3921:Masp2	UTSW	4	148605731	missense	possibly damaging	0.95
R4586:Masp2	UTSW	4	148613901	missense	probably damaging	1.00
R4753:Masp2	UTSW	4	148612151	missense	probably benign	0.00
R4877:Masp2	UTSW	4	148602871	missense	probably benign	0.00
R5169:Masp2	UTSW	4	148606114	missense	probably damaging	0.96
R5512:Masp2	UTSW	4	148614069	missense	probably damaging	1.00
R6161:Masp2	UTSW	4	148614012	missense	possibly damaging	0.88
R6291:Masp2	UTSW	4	148602753	missense	probably damaging	0.99
R7039:Masp2	UTSW	4	148602586	start codon destroyed	probably benign	0.03
R7164:Masp2	UTSW	4	148610115	critical splice acceptor site	probably null
R7183:Masp2	UTSW	4	148612157	missense	probably benign	0.02
R7417:Masp2	UTSW	4	148605721	missense	probably benign	0.02
R7718:Masp2	UTSW	4	148602747	missense	probably damaging	1.00
R7852:Masp2	UTSW	4	148602732	missense	probably benign	0.00
R7986:Masp2	UTSW	4	148602826	missense	probably damaging	1.00
R8078:Masp2	UTSW	4	148613778	missense	probably benign	0.01
R8203:Masp2	UTSW	4	148612142	missense	probably benign	0.00
R8257:Masp2	UTSW	4	148603040	missense	possibly damaging	0.82
R8465:Masp2	UTSW	4	148612059	missense	possibly damaging	0.79
R9324:Masp2	UTSW	4	148608028	missense	possibly damaging	0.65
R9350:Masp2	UTSW	4	148607939	critical splice acceptor site	probably null
R9706:Masp2	UTSW	4	148612140	missense	probably benign	0.03
X0025:Masp2	UTSW	4	148602723	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTCGCAGGCATTCTCTATCC -3'
(R):5'- AGCCCCGCAAAGAAAGGTTG -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- GGTTGATTAAGATTCACTGGAGAAC -3'

Posted On

2019-11-26