Incidental Mutation 'R7748:Bod1l'
ID 596981
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Name biorientation of chromosomes in cell division 1-like
Synonyms A230054D04Rik
MMRRC Submission 045804-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R7748 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 41944881-42001658 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 41989683 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 347 (S347A)
Ref Sequence ENSEMBL: ENSMUSP00000058618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000050556
AA Change: S347A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: S347A

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202908
AA Change: S347A

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: S347A

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 130,963,521 (GRCm39) L103F probably benign Het
5330417H12Rik A G 7: 107,223,765 (GRCm39) L103P unknown Het
Actb T C 5: 142,890,450 (GRCm39) I151V probably benign Het
Adcy6 T A 15: 98,502,437 (GRCm39) H59L probably benign Het
Adss2 G C 1: 177,599,768 (GRCm39) S272* probably null Het
Aga A T 8: 53,964,840 (GRCm39) M1L possibly damaging Het
Ajm1 T A 2: 25,468,971 (GRCm39) E313D possibly damaging Het
Anxa5 G A 3: 36,519,480 (GRCm39) T3M probably damaging Het
Arhgap45 A T 10: 79,852,766 (GRCm39) probably benign Het
Atp6v0a2 A T 5: 124,793,560 (GRCm39) H639L probably benign Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bltp1 A G 3: 37,013,484 (GRCm39) probably null Het
Calcoco1 T C 15: 102,627,996 (GRCm39) D46G probably damaging Het
Camk1 T C 6: 113,317,289 (GRCm39) E60G probably damaging Het
Capza1 A T 3: 104,732,721 (GRCm39) probably null Het
Ccdc18 T A 5: 108,296,907 (GRCm39) probably null Het
Cdh20 G A 1: 104,869,024 (GRCm39) A172T probably damaging Het
Cdk4 C T 10: 126,900,298 (GRCm39) A65V possibly damaging Het
Cftr T C 6: 18,277,888 (GRCm39) probably null Het
Chd3 T C 11: 69,246,459 (GRCm39) M1092V probably benign Het
Chd6 A T 2: 160,808,539 (GRCm39) H1558Q probably benign Het
Chi3l1 A G 1: 134,116,966 (GRCm39) H318R probably benign Het
Cps1 A G 1: 67,178,965 (GRCm39) Y59C probably damaging Het
Cyb5r4 T C 9: 86,914,434 (GRCm39) V111A probably damaging Het
Ddx39b G A 17: 35,471,726 (GRCm39) V291M probably damaging Het
Dhx57 A G 17: 80,572,546 (GRCm39) F709S probably damaging Het
Eef1b2 A T 1: 63,217,024 (GRCm39) K64N probably damaging Het
Eef1ece2 A T 16: 20,451,834 (GRCm39) D407V probably damaging Het
Fam135a A G 1: 24,068,050 (GRCm39) S940P probably benign Het
Fam234b T A 6: 135,186,349 (GRCm39) V119E probably damaging Het
Fbxo46 G C 7: 18,870,458 (GRCm39) C359S probably damaging Het
Fkbp14 C A 6: 54,572,505 (GRCm39) probably benign Het
Fmn2 T A 1: 174,494,215 (GRCm39) V1243E probably damaging Het
Fsbp C A 4: 11,579,924 (GRCm39) T64K probably damaging Het
Fscb A T 12: 64,521,181 (GRCm39) M95K probably benign Het
Fyb1 T G 15: 6,668,307 (GRCm39) V500G probably damaging Het
G2e3 A G 12: 51,418,450 (GRCm39) N615S probably benign Het
Gart T C 16: 91,427,540 (GRCm39) D486G possibly damaging Het
Gas2l2 T A 11: 83,313,224 (GRCm39) D696V probably benign Het
Glmn C T 5: 107,710,110 (GRCm39) probably null Het
Gm47985 A T 1: 151,058,725 (GRCm39) D122V probably damaging Het
Gm7168 A G 17: 14,168,914 (GRCm39) K94E probably benign Het
Gnai2 T C 9: 107,492,934 (GRCm39) H323R Het
Helz2 C T 2: 180,876,324 (GRCm39) R1390H probably damaging Het
Igf2bp1 T C 11: 95,858,413 (GRCm39) M453V probably benign Het
Ighv3-1 C T 12: 113,928,270 (GRCm39) V30M probably damaging Het
Inpp5a A T 7: 139,154,911 (GRCm39) R343S probably damaging Het
Itga8 T A 2: 12,235,050 (GRCm39) I403F possibly damaging Het
Katnip A T 7: 125,428,973 (GRCm39) M558L probably benign Het
Krt33a C T 11: 99,902,428 (GRCm39) R404H probably benign Het
Krt34 T A 11: 99,929,764 (GRCm39) E244V probably damaging Het
Krt42 T C 11: 100,157,792 (GRCm39) E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 141,728,845 (GRCm39) probably benign Het
Lama1 T C 17: 68,057,585 (GRCm39) L553P Het
Lcn9 T A 2: 25,714,926 (GRCm39) *179K probably null Het
Ldaf1 A T 7: 119,714,702 (GRCm39) I64F possibly damaging Het
Lrrc2 T G 9: 110,809,999 (GRCm39) M345R possibly damaging Het
Marchf11 T C 15: 26,387,916 (GRCm39) V257A probably damaging Het
Masp2 T C 4: 148,690,163 (GRCm39) I224T probably benign Het
Mpz A T 1: 170,987,509 (GRCm39) probably null Het
Mtr C T 13: 12,242,725 (GRCm39) A442T probably benign Het
Muc5b A G 7: 141,401,542 (GRCm39) K596R unknown Het
Myo15a T G 11: 60,395,727 (GRCm39) F1397C Het
Ncor2 T C 5: 125,187,031 (GRCm39) I173V unknown Het
Ngly1 T A 14: 16,290,820 (GRCm38) I434K possibly damaging Het
Notch2 A G 3: 98,045,800 (GRCm39) H1655R possibly damaging Het
Notum C T 11: 120,545,627 (GRCm39) A390T probably damaging Het
Or10a3n T C 7: 108,493,285 (GRCm39) T115A probably benign Het
Or1e22 T G 11: 73,376,994 (GRCm39) I219L probably benign Het
Pds5a T A 5: 65,777,009 (GRCm39) I51F possibly damaging Het
Pdzd2 C A 15: 12,385,872 (GRCm39) R966L possibly damaging Het
Plk3 T C 4: 116,988,925 (GRCm39) Y278C probably damaging Het
Plxna1 C G 6: 89,314,334 (GRCm39) probably null Het
Plxna1 T A 6: 89,314,335 (GRCm39) probably null Het
Ppp4r4 G A 12: 103,571,320 (GRCm39) probably null Het
Pramel6 T A 2: 87,339,043 (GRCm39) V81E probably damaging Het
Prdm2 T C 4: 142,862,459 (GRCm39) E277G possibly damaging Het
Prkg1 T A 19: 30,970,491 (GRCm39) I222F possibly damaging Het
Proser3 A T 7: 30,239,497 (GRCm39) S536T possibly damaging Het
Prrt4 C A 6: 29,177,190 (GRCm39) G193V probably damaging Het
Ptpn21 A T 12: 98,655,031 (GRCm39) H645Q probably benign Het
Ptprd T C 4: 76,017,741 (GRCm39) I744V probably null Het
Rad54l2 A G 9: 106,596,233 (GRCm39) V235A possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rgs22 C T 15: 36,122,415 (GRCm39) probably null Het
Rtcb A T 10: 85,777,832 (GRCm39) D447E probably benign Het
Rtn1 C T 12: 72,263,700 (GRCm39) V744I possibly damaging Het
Scfd1 T G 12: 51,436,140 (GRCm39) I96M probably benign Het
Serpina3b T C 12: 104,096,722 (GRCm39) M1T probably null Het
Slc1a4 T C 11: 20,282,252 (GRCm39) Y74C probably damaging Het
Slc9b2 A T 3: 135,031,940 (GRCm39) I267F possibly damaging Het
Sorcs2 A T 5: 36,386,519 (GRCm39) M173K possibly damaging Het
Sparc T C 11: 55,289,426 (GRCm39) I226V probably benign Het
Spata22 T G 11: 73,227,080 (GRCm39) I98S probably null Het
Spef2 C T 15: 9,653,031 (GRCm39) V917M probably damaging Het
Sspo C A 6: 48,426,399 (GRCm39) C139* probably null Het
Tenm4 A G 7: 96,543,909 (GRCm39) D2012G probably damaging Het
Tgm5 G A 2: 120,883,289 (GRCm39) R351C probably damaging Het
Tmem145 G A 7: 25,006,753 (GRCm39) W82* probably null Het
Topors T A 4: 40,262,654 (GRCm39) D210V probably damaging Het
Tssk4 A T 14: 55,888,569 (GRCm39) H146L probably damaging Het
Unc93b1 T A 19: 3,985,250 (GRCm39) D19E unknown Het
Usp17lc A G 7: 103,067,688 (GRCm39) T328A probably damaging Het
Utrn A G 10: 12,490,252 (GRCm39) Y43H probably benign Het
Vmn1r25 T A 6: 57,955,549 (GRCm39) I247F probably damaging Het
Vmn2r78 A T 7: 86,570,343 (GRCm39) Q287L probably benign Het
Vps13c T A 9: 67,870,371 (GRCm39) I3170N probably benign Het
Zfc3h1 T A 10: 115,236,720 (GRCm39) M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp773 T C 7: 7,135,907 (GRCm39) R230G probably benign Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41,974,166 (GRCm39) missense probably benign 0.00
IGL00990:Bod1l APN 5 41,986,208 (GRCm39) missense probably benign 0.00
IGL01021:Bod1l APN 5 41,995,516 (GRCm39) splice site probably benign
IGL01022:Bod1l APN 5 41,951,652 (GRCm39) missense probably damaging 1.00
IGL01303:Bod1l APN 5 41,974,942 (GRCm39) missense probably benign 0.00
IGL01654:Bod1l APN 5 41,975,519 (GRCm39) missense probably damaging 0.99
IGL01748:Bod1l APN 5 41,974,304 (GRCm39) missense probably benign 0.23
IGL01758:Bod1l APN 5 41,983,953 (GRCm39) splice site probably benign
IGL01783:Bod1l APN 5 41,966,055 (GRCm39) missense probably benign 0.02
IGL01790:Bod1l APN 5 41,989,593 (GRCm39) missense probably benign 0.14
IGL01803:Bod1l APN 5 41,974,732 (GRCm39) missense probably damaging 0.97
IGL01829:Bod1l APN 5 41,977,811 (GRCm39) missense probably benign 0.25
IGL01952:Bod1l APN 5 41,974,297 (GRCm39) missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41,973,682 (GRCm39) missense probably benign 0.01
IGL02110:Bod1l APN 5 41,973,796 (GRCm39) missense probably damaging 0.97
IGL02129:Bod1l APN 5 41,979,193 (GRCm39) missense probably benign 0.36
IGL02572:Bod1l APN 5 41,978,573 (GRCm39) nonsense probably null
IGL02583:Bod1l APN 5 41,973,550 (GRCm39) critical splice donor site probably null
IGL02643:Bod1l APN 5 41,976,148 (GRCm39) missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41,973,682 (GRCm39) missense probably benign 0.01
IGL02728:Bod1l APN 5 41,983,846 (GRCm39) missense probably damaging 1.00
IGL02752:Bod1l APN 5 41,973,806 (GRCm39) missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41,951,688 (GRCm39) missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41,988,927 (GRCm39) missense probably benign 0.16
IGL03372:Bod1l APN 5 41,962,578 (GRCm39) splice site probably benign
capacitance UTSW 5 41,949,156 (GRCm39) missense possibly damaging 0.91
gauss UTSW 5 41,974,210 (GRCm39) missense probably benign 0.01
Tesla UTSW 5 41,952,411 (GRCm39) critical splice donor site probably null
R0102:Bod1l UTSW 5 41,974,612 (GRCm39) missense probably benign 0.36
R0147:Bod1l UTSW 5 41,976,040 (GRCm39) missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41,976,040 (GRCm39) missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41,979,235 (GRCm39) missense probably damaging 0.96
R0577:Bod1l UTSW 5 41,952,230 (GRCm39) missense probably damaging 1.00
R0587:Bod1l UTSW 5 41,978,980 (GRCm39) missense probably benign 0.16
R0620:Bod1l UTSW 5 41,958,576 (GRCm39) missense probably benign 0.16
R0626:Bod1l UTSW 5 41,988,880 (GRCm39) missense probably damaging 1.00
R0785:Bod1l UTSW 5 41,977,359 (GRCm39) missense probably benign 0.00
R1139:Bod1l UTSW 5 41,988,814 (GRCm39) missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41,978,396 (GRCm39) missense probably benign 0.02
R1418:Bod1l UTSW 5 41,976,814 (GRCm39) missense probably damaging 1.00
R1509:Bod1l UTSW 5 41,976,883 (GRCm39) missense probably damaging 0.99
R1533:Bod1l UTSW 5 41,979,498 (GRCm39) nonsense probably null
R1538:Bod1l UTSW 5 41,973,772 (GRCm39) missense probably benign 0.00
R1591:Bod1l UTSW 5 41,976,563 (GRCm39) missense probably benign 0.06
R1616:Bod1l UTSW 5 41,966,058 (GRCm39) missense probably benign
R1628:Bod1l UTSW 5 41,974,325 (GRCm39) missense probably benign 0.01
R1667:Bod1l UTSW 5 41,974,118 (GRCm39) missense probably benign 0.01
R1869:Bod1l UTSW 5 41,991,018 (GRCm39) missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41,991,018 (GRCm39) missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41,974,679 (GRCm39) missense probably damaging 1.00
R2060:Bod1l UTSW 5 41,966,085 (GRCm39) missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41,962,499 (GRCm39) missense probably damaging 0.99
R2067:Bod1l UTSW 5 41,974,429 (GRCm39) missense probably benign 0.11
R2073:Bod1l UTSW 5 41,976,532 (GRCm39) missense probably benign 0.19
R2092:Bod1l UTSW 5 41,988,860 (GRCm39) missense probably damaging 1.00
R2105:Bod1l UTSW 5 41,989,622 (GRCm39) missense probably benign 0.00
R2243:Bod1l UTSW 5 41,978,888 (GRCm39) missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41,984,463 (GRCm39) missense probably benign 0.09
R2849:Bod1l UTSW 5 41,995,419 (GRCm39) missense probably damaging 1.00
R2883:Bod1l UTSW 5 41,989,602 (GRCm39) missense probably benign 0.03
R3037:Bod1l UTSW 5 41,979,380 (GRCm39) missense probably damaging 0.99
R3910:Bod1l UTSW 5 41,974,441 (GRCm39) missense probably damaging 0.99
R3911:Bod1l UTSW 5 41,974,441 (GRCm39) missense probably damaging 0.99
R3962:Bod1l UTSW 5 41,966,064 (GRCm39) missense probably benign 0.07
R4235:Bod1l UTSW 5 41,978,798 (GRCm39) missense probably damaging 1.00
R4308:Bod1l UTSW 5 41,949,156 (GRCm39) missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41,977,870 (GRCm39) missense probably benign 0.04
R4535:Bod1l UTSW 5 41,989,574 (GRCm39) missense probably benign 0.06
R4631:Bod1l UTSW 5 41,975,078 (GRCm39) missense probably damaging 1.00
R4657:Bod1l UTSW 5 41,975,955 (GRCm39) missense probably benign 0.00
R4782:Bod1l UTSW 5 41,991,006 (GRCm39) missense probably benign 0.06
R4786:Bod1l UTSW 5 41,976,781 (GRCm39) missense probably benign 0.43
R4840:Bod1l UTSW 5 41,975,815 (GRCm39) missense probably damaging 1.00
R4877:Bod1l UTSW 5 41,977,337 (GRCm39) missense probably benign 0.00
R4982:Bod1l UTSW 5 41,977,816 (GRCm39) missense probably benign 0.00
R5152:Bod1l UTSW 5 41,973,886 (GRCm39) missense probably benign 0.04
R5284:Bod1l UTSW 5 41,977,810 (GRCm39) missense probably benign 0.05
R5354:Bod1l UTSW 5 41,988,880 (GRCm39) missense probably damaging 1.00
R5369:Bod1l UTSW 5 41,984,526 (GRCm39) missense probably damaging 1.00
R5486:Bod1l UTSW 5 41,964,524 (GRCm39) missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41,949,276 (GRCm39) missense probably benign 0.06
R5610:Bod1l UTSW 5 41,979,217 (GRCm39) missense probably damaging 1.00
R5655:Bod1l UTSW 5 41,974,387 (GRCm39) missense probably benign 0.06
R5705:Bod1l UTSW 5 41,974,345 (GRCm39) missense probably benign 0.01
R5819:Bod1l UTSW 5 41,989,948 (GRCm39) missense probably benign 0.27
R5890:Bod1l UTSW 5 41,977,921 (GRCm39) missense probably benign 0.43
R5923:Bod1l UTSW 5 41,974,762 (GRCm39) missense probably damaging 1.00
R5991:Bod1l UTSW 5 41,974,206 (GRCm39) nonsense probably null
R6017:Bod1l UTSW 5 41,976,103 (GRCm39) missense probably benign 0.01
R6253:Bod1l UTSW 5 41,983,881 (GRCm39) missense probably damaging 0.96
R6284:Bod1l UTSW 5 41,976,130 (GRCm39) missense probably benign 0.35
R6483:Bod1l UTSW 5 41,978,425 (GRCm39) missense probably benign 0.03
R6485:Bod1l UTSW 5 41,974,459 (GRCm39) missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41,995,411 (GRCm39) missense probably damaging 1.00
R6679:Bod1l UTSW 5 41,974,009 (GRCm39) missense probably damaging 0.97
R6788:Bod1l UTSW 5 41,979,216 (GRCm39) nonsense probably null
R7006:Bod1l UTSW 5 41,989,895 (GRCm39) missense probably damaging 1.00
R7095:Bod1l UTSW 5 41,952,411 (GRCm39) critical splice donor site probably null
R7111:Bod1l UTSW 5 41,970,463 (GRCm39) critical splice donor site probably null
R7190:Bod1l UTSW 5 41,977,281 (GRCm39) missense probably benign 0.14
R7311:Bod1l UTSW 5 41,951,676 (GRCm39) missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41,978,867 (GRCm39) missense probably damaging 1.00
R7341:Bod1l UTSW 5 41,946,200 (GRCm39) missense probably benign 0.00
R7396:Bod1l UTSW 5 41,988,889 (GRCm39) missense probably damaging 1.00
R7431:Bod1l UTSW 5 41,970,463 (GRCm39) critical splice donor site probably null
R7442:Bod1l UTSW 5 41,964,522 (GRCm39) missense probably damaging 0.96
R7539:Bod1l UTSW 5 41,975,203 (GRCm39) missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41,991,133 (GRCm39) missense probably damaging 1.00
R7679:Bod1l UTSW 5 41,977,986 (GRCm39) frame shift probably null
R7767:Bod1l UTSW 5 41,974,099 (GRCm39) missense probably benign 0.01
R7773:Bod1l UTSW 5 41,990,055 (GRCm39) missense probably benign 0.14
R7782:Bod1l UTSW 5 41,975,286 (GRCm39) missense probably benign 0.01
R7860:Bod1l UTSW 5 41,976,608 (GRCm39) missense probably damaging 1.00
R7975:Bod1l UTSW 5 41,973,620 (GRCm39) missense possibly damaging 0.90
R7977:Bod1l UTSW 5 41,952,413 (GRCm39) missense probably damaging 1.00
R7987:Bod1l UTSW 5 41,952,413 (GRCm39) missense probably damaging 1.00
R8104:Bod1l UTSW 5 41,991,075 (GRCm39) nonsense probably null
R8217:Bod1l UTSW 5 41,988,850 (GRCm39) missense probably damaging 1.00
R8307:Bod1l UTSW 5 41,978,498 (GRCm39) missense probably damaging 1.00
R8469:Bod1l UTSW 5 41,978,834 (GRCm39) missense possibly damaging 0.86
R8506:Bod1l UTSW 5 41,976,398 (GRCm39) nonsense probably null
R8934:Bod1l UTSW 5 41,976,944 (GRCm39) missense probably benign 0.11
R8984:Bod1l UTSW 5 41,946,215 (GRCm39) missense probably damaging 1.00
R8989:Bod1l UTSW 5 41,979,025 (GRCm39) missense probably benign 0.00
R8993:Bod1l UTSW 5 41,974,210 (GRCm39) missense probably benign 0.01
R9128:Bod1l UTSW 5 41,946,266 (GRCm39) missense probably benign 0.22
R9129:Bod1l UTSW 5 41,976,220 (GRCm39) missense probably damaging 0.99
R9198:Bod1l UTSW 5 41,957,129 (GRCm39) missense probably benign 0.08
R9254:Bod1l UTSW 5 41,979,223 (GRCm39) missense probably damaging 1.00
R9445:Bod1l UTSW 5 41,974,619 (GRCm39) missense probably benign 0.04
R9457:Bod1l UTSW 5 41,979,310 (GRCm39) missense probably damaging 0.99
R9470:Bod1l UTSW 5 41,974,439 (GRCm39) missense probably damaging 0.99
R9536:Bod1l UTSW 5 41,974,305 (GRCm39) missense probably benign 0.01
R9654:Bod1l UTSW 5 41,975,707 (GRCm39) missense probably benign 0.02
R9734:Bod1l UTSW 5 41,962,573 (GRCm39) missense possibly damaging 0.91
R9771:Bod1l UTSW 5 41,949,206 (GRCm39) missense probably damaging 0.96
X0027:Bod1l UTSW 5 41,990,012 (GRCm39) missense probably benign 0.20
X0058:Bod1l UTSW 5 41,981,361 (GRCm39) missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41,966,107 (GRCm39) missense possibly damaging 0.95
Z1088:Bod1l UTSW 5 41,978,489 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAACGTGACACTGTCCTC -3'
(R):5'- TGATCTCCCTTGTCCAGTGG -3'

Sequencing Primer
(F):5'- GTGACACTGTCCTCTTCCTGTAAGG -3'
(R):5'- TCTCCCTTGTCCAGTGGAAGAAAC -3'
Posted On 2019-11-26