Mutagenetix > Incidental Mutation

Incidental Mutation 'R7748:Atp6v0a2'

596985

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

045804-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R7748 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 124716496 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 639 (H639L)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000197161] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000037865
AA Change: H639L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: H639L

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197161

SMART Domains

Protein: ENSMUSP00000143461
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	T	A	7: 131,361,792	L103F	probably benign	Het
4932438A13Rik	A	G	3: 36,959,335		probably null	Het
5330417H12Rik	A	G	7: 107,624,558	L103P	unknown	Het
Actb	T	C	5: 142,904,695	I151V	probably benign	Het
Adcy6	T	A	15: 98,604,556	H59L	probably benign	Het
Adss	G	C	1: 177,772,202	S272*	probably null	Het
Aga	A	T	8: 53,511,805	M1L	possibly damaging	Het
Anxa5	G	A	3: 36,465,331	T3M	probably damaging	Het
Arhgap45	A	T	10: 80,016,932		probably benign	Het
BC005537	C	T	13: 24,803,399	R7W	possibly damaging	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bod1l	A	C	5: 41,832,340	S347A	probably damaging	Het
Calcoco1	T	C	15: 102,719,561	D46G	probably damaging	Het
Camk1	T	C	6: 113,340,328	E60G	probably damaging	Het
Capza1	A	T	3: 104,825,405		probably null	Het
Ccdc18	T	A	5: 108,149,041		probably null	Het
Cdh20	G	A	1: 104,941,299	A172T	probably damaging	Het
Cdk4	C	T	10: 127,064,429	A65V	possibly damaging	Het
Cftr	T	C	6: 18,277,889		probably null	Het
Chd3	T	C	11: 69,355,633	M1092V	probably benign	Het
Chd6	A	T	2: 160,966,619	H1558Q	probably benign	Het
Chil1	A	G	1: 134,189,228	H318R	probably benign	Het
Cps1	A	G	1: 67,139,806	Y59C	probably damaging	Het
Cyb5r4	T	C	9: 87,032,381	V111A	probably damaging	Het
D430042O09Rik	A	T	7: 125,829,801	M558L	probably benign	Het
Ddx39b	G	A	17: 35,252,750	V291M	probably damaging	Het
Dhx57	A	G	17: 80,265,117	F709S	probably damaging	Het
Eef1b2	A	T	1: 63,177,865	K64N	probably damaging	Het
Fam135a	A	G	1: 24,028,969	S940P	probably benign	Het
Fam234b	T	A	6: 135,209,351	V119E	probably damaging	Het
Fbxo46	G	C	7: 19,136,533	C359S	probably damaging	Het
Fkbp14	C	A	6: 54,595,520		probably benign	Het
Fmn2	T	A	1: 174,666,649	V1243E	probably damaging	Het
Fsbp	C	A	4: 11,579,924	T64K	probably damaging	Het
Fscb	A	T	12: 64,474,407	M95K	probably benign	Het
Fyb	T	G	15: 6,638,826	V500G	probably damaging	Het
G2e3	A	G	12: 51,371,667	N615S	probably benign	Het
Gart	T	C	16: 91,630,652	D486G	possibly damaging	Het
Gas2l2	T	A	11: 83,422,398	D696V	probably benign	Het
Glmn	C	T	5: 107,562,244		probably null	Het
Gm47985	A	T	1: 151,182,974	D122V	probably damaging	Het
Gm49333	A	T	16: 20,633,084	D407V	probably damaging	Het
Gm7168	A	G	17: 13,948,652	K94E	probably benign	Het
Gm996	T	A	2: 25,578,959	E313D	possibly damaging	Het
Gnai2	T	C	9: 107,615,735	H323R		Het
Helz2	C	T	2: 181,234,531	R1390H	probably damaging	Het
Igf2bp1	T	C	11: 95,967,587	M453V	probably benign	Het
Ighv3-1	C	T	12: 113,964,650	V30M	probably damaging	Het
Inpp5a	A	T	7: 139,574,995	R343S	probably damaging	Het
Itga8	T	A	2: 12,230,239	I403F	possibly damaging	Het
Krt33a	C	T	11: 100,011,602	R404H	probably benign	Het
Krt34	T	A	11: 100,038,938	E244V	probably damaging	Het
Krt42	T	C	11: 100,266,966	E224G	probably damaging	Het
Krtap5-2	TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA	TCCACAGGAACTACA	7: 142,175,108		probably benign	Het
Lama1	T	C	17: 67,750,590	L553P		Het
Lcn9	T	A	2: 25,824,914	*179K	probably null	Het
Lrrc2	T	G	9: 110,980,931	M345R	possibly damaging	Het
March11	T	C	15: 26,387,830	V257A	probably damaging	Het
Masp2	T	C	4: 148,605,706	I224T	probably benign	Het
Mpz	A	T	1: 171,159,940		probably null	Het
Mtr	C	T	13: 12,227,839	A442T	probably benign	Het
Muc5b	A	G	7: 141,847,805	K596R	unknown	Het
Myo15	T	G	11: 60,504,901	F1397C		Het
Ncor2	T	C	5: 125,109,967	I173V	unknown	Het
Ngly1	T	A	14: 16,290,820	I434K	possibly damaging	Het
Notch2	A	G	3: 98,138,484	H1655R	possibly damaging	Het
Notum	C	T	11: 120,654,801	A390T	probably damaging	Het
Olfr381	T	G	11: 73,486,168	I219L	probably benign	Het
Olfr519	T	C	7: 108,894,078	T115A	probably benign	Het
Pds5a	T	A	5: 65,619,666	I51F	possibly damaging	Het
Pdzd2	C	A	15: 12,385,786	R966L	possibly damaging	Het
Plk3	T	C	4: 117,131,728	Y278C	probably damaging	Het
Plxna1	C	G	6: 89,337,352		probably null	Het
Plxna1	T	A	6: 89,337,353		probably null	Het
Ppp4r4	G	A	12: 103,605,061		probably null	Het
Pramel6	T	A	2: 87,508,699	V81E	probably damaging	Het
Prdm2	T	C	4: 143,135,889	E277G	possibly damaging	Het
Prkg1	T	A	19: 30,993,091	I222F	possibly damaging	Het
Proser3	A	T	7: 30,540,072	S536T	possibly damaging	Het
Prrt4	C	A	6: 29,177,191	G193V	probably damaging	Het
Ptpn21	A	T	12: 98,688,772	H645Q	probably benign	Het
Ptprd	T	C	4: 76,099,504	I744V	probably null	Het
Rad54l2	A	G	9: 106,719,034	V235A	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rgs22	C	T	15: 36,122,269		probably null	Het
Rtcb	A	T	10: 85,941,968	D447E	probably benign	Het
Rtn1	C	T	12: 72,216,926	V744I	possibly damaging	Het
Scfd1	T	G	12: 51,389,357	I96M	probably benign	Het
Serpina3b	T	C	12: 104,130,463	M1T	probably null	Het
Slc1a4	T	C	11: 20,332,252	Y74C	probably damaging	Het
Slc9b2	A	T	3: 135,326,179	I267F	possibly damaging	Het
Sorcs2	A	T	5: 36,229,175	M173K	possibly damaging	Het
Sparc	T	C	11: 55,398,600	I226V	probably benign	Het
Spata22	T	G	11: 73,336,254	I98S	probably null	Het
Spef2	C	T	15: 9,652,945	V917M	probably damaging	Het
Sspo	C	A	6: 48,449,465	C139*	probably null	Het
Tenm4	A	G	7: 96,894,702	D2012G	probably damaging	Het
Tgm5	G	A	2: 121,052,808	R351C	probably damaging	Het
Tmem145	G	A	7: 25,307,328	W82*	probably null	Het
Tmem159	A	T	7: 120,115,479	I64F	possibly damaging	Het
Topors	T	A	4: 40,262,654	D210V	probably damaging	Het
Tssk4	A	T	14: 55,651,112	H146L	probably damaging	Het
Unc93b1	T	A	19: 3,935,250	D19E	unknown	Het
Usp17lc	A	G	7: 103,418,481	T328A	probably damaging	Het
Utrn	A	G	10: 12,614,508	Y43H	probably benign	Het
Vmn1r25	T	A	6: 57,978,564	I247F	probably damaging	Het
Vmn2r78	A	T	7: 86,921,135	Q287L	probably benign	Het
Vps13c	T	A	9: 67,963,089	I3170N	probably benign	Het
Zfc3h1	T	A	10: 115,400,815	M398K	probably benign	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp773	T	C	7: 7,132,908	R230G	probably benign	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGCGCCATAACAACAGAGC -3'
(R):5'- ATTCTGAGAACACTGCAAAAGG -3'

Sequencing Primer
(F):5'- GAAGAAGTTCAACGTCTACCTGGTC -3'
(R):5'- TTCTGAGAACACTGCAAAAGGAGAAG -3'

Posted On

2019-11-26