Incidental Mutation 'R7748:Plxna1'
ID 596994
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Name plexin A1
Synonyms NOV, Plxn1, PlexA1, 2600013D04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock # R7748 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 89316314-89362620 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) C to G at 89337352 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000049845] [ENSMUST00000163139] [ENSMUST00000163139]
AlphaFold P70206
PDB Structure The Plexin A1 intracellular region in complex with Rac1 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000049845
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000049845
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163139
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163139
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205121
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,361,792 L103F probably benign Het
4932438A13Rik A G 3: 36,959,335 probably null Het
5330417H12Rik A G 7: 107,624,558 L103P unknown Het
Actb T C 5: 142,904,695 I151V probably benign Het
Adcy6 T A 15: 98,604,556 H59L probably benign Het
Adss G C 1: 177,772,202 S272* probably null Het
Aga A T 8: 53,511,805 M1L possibly damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgap45 A T 10: 80,016,932 probably benign Het
Atp6v0a2 A T 5: 124,716,496 H639L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bod1l A C 5: 41,832,340 S347A probably damaging Het
Calcoco1 T C 15: 102,719,561 D46G probably damaging Het
Camk1 T C 6: 113,340,328 E60G probably damaging Het
Capza1 A T 3: 104,825,405 probably null Het
Ccdc18 T A 5: 108,149,041 probably null Het
Cdh20 G A 1: 104,941,299 A172T probably damaging Het
Cdk4 C T 10: 127,064,429 A65V possibly damaging Het
Cftr T C 6: 18,277,889 probably null Het
Chd3 T C 11: 69,355,633 M1092V probably benign Het
Chd6 A T 2: 160,966,619 H1558Q probably benign Het
Chil1 A G 1: 134,189,228 H318R probably benign Het
Cps1 A G 1: 67,139,806 Y59C probably damaging Het
Cyb5r4 T C 9: 87,032,381 V111A probably damaging Het
D430042O09Rik A T 7: 125,829,801 M558L probably benign Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dhx57 A G 17: 80,265,117 F709S probably damaging Het
Eef1b2 A T 1: 63,177,865 K64N probably damaging Het
Fam135a A G 1: 24,028,969 S940P probably benign Het
Fam234b T A 6: 135,209,351 V119E probably damaging Het
Fbxo46 G C 7: 19,136,533 C359S probably damaging Het
Fkbp14 C A 6: 54,595,520 probably benign Het
Fmn2 T A 1: 174,666,649 V1243E probably damaging Het
Fsbp C A 4: 11,579,924 T64K probably damaging Het
Fscb A T 12: 64,474,407 M95K probably benign Het
Fyb T G 15: 6,638,826 V500G probably damaging Het
G2e3 A G 12: 51,371,667 N615S probably benign Het
Gart T C 16: 91,630,652 D486G possibly damaging Het
Gas2l2 T A 11: 83,422,398 D696V probably benign Het
Glmn C T 5: 107,562,244 probably null Het
Gm47985 A T 1: 151,182,974 D122V probably damaging Het
Gm49333 A T 16: 20,633,084 D407V probably damaging Het
Gm7168 A G 17: 13,948,652 K94E probably benign Het
Gm996 T A 2: 25,578,959 E313D possibly damaging Het
Gnai2 T C 9: 107,615,735 H323R Het
Helz2 C T 2: 181,234,531 R1390H probably damaging Het
Igf2bp1 T C 11: 95,967,587 M453V probably benign Het
Ighv3-1 C T 12: 113,964,650 V30M probably damaging Het
Inpp5a A T 7: 139,574,995 R343S probably damaging Het
Itga8 T A 2: 12,230,239 I403F possibly damaging Het
Krt33a C T 11: 100,011,602 R404H probably benign Het
Krt34 T A 11: 100,038,938 E244V probably damaging Het
Krt42 T C 11: 100,266,966 E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Lama1 T C 17: 67,750,590 L553P Het
Lcn9 T A 2: 25,824,914 *179K probably null Het
Lrrc2 T G 9: 110,980,931 M345R possibly damaging Het
March11 T C 15: 26,387,830 V257A probably damaging Het
Masp2 T C 4: 148,605,706 I224T probably benign Het
Mpz A T 1: 171,159,940 probably null Het
Mtr C T 13: 12,227,839 A442T probably benign Het
Muc5b A G 7: 141,847,805 K596R unknown Het
Myo15 T G 11: 60,504,901 F1397C Het
Ncor2 T C 5: 125,109,967 I173V unknown Het
Ngly1 T A 14: 16,290,820 I434K possibly damaging Het
Notch2 A G 3: 98,138,484 H1655R possibly damaging Het
Notum C T 11: 120,654,801 A390T probably damaging Het
Olfr381 T G 11: 73,486,168 I219L probably benign Het
Olfr519 T C 7: 108,894,078 T115A probably benign Het
Pds5a T A 5: 65,619,666 I51F possibly damaging Het
Pdzd2 C A 15: 12,385,786 R966L possibly damaging Het
Plk3 T C 4: 117,131,728 Y278C probably damaging Het
Ppp4r4 G A 12: 103,605,061 probably null Het
Pramel6 T A 2: 87,508,699 V81E probably damaging Het
Prdm2 T C 4: 143,135,889 E277G possibly damaging Het
Prkg1 T A 19: 30,993,091 I222F possibly damaging Het
Proser3 A T 7: 30,540,072 S536T possibly damaging Het
Prrt4 C A 6: 29,177,191 G193V probably damaging Het
Ptpn21 A T 12: 98,688,772 H645Q probably benign Het
Ptprd T C 4: 76,099,504 I744V probably null Het
Rad54l2 A G 9: 106,719,034 V235A possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs22 C T 15: 36,122,269 probably null Het
Rtcb A T 10: 85,941,968 D447E probably benign Het
Rtn1 C T 12: 72,216,926 V744I possibly damaging Het
Scfd1 T G 12: 51,389,357 I96M probably benign Het
Serpina3b T C 12: 104,130,463 M1T probably null Het
Slc1a4 T C 11: 20,332,252 Y74C probably damaging Het
Slc9b2 A T 3: 135,326,179 I267F possibly damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Sparc T C 11: 55,398,600 I226V probably benign Het
Spata22 T G 11: 73,336,254 I98S probably null Het
Spef2 C T 15: 9,652,945 V917M probably damaging Het
Sspo C A 6: 48,449,465 C139* probably null Het
Tenm4 A G 7: 96,894,702 D2012G probably damaging Het
Tgm5 G A 2: 121,052,808 R351C probably damaging Het
Tmem145 G A 7: 25,307,328 W82* probably null Het
Tmem159 A T 7: 120,115,479 I64F possibly damaging Het
Topors T A 4: 40,262,654 D210V probably damaging Het
Tssk4 A T 14: 55,651,112 H146L probably damaging Het
Unc93b1 T A 19: 3,935,250 D19E unknown Het
Usp17lc A G 7: 103,418,481 T328A probably damaging Het
Utrn A G 10: 12,614,508 Y43H probably benign Het
Vmn1r25 T A 6: 57,978,564 I247F probably damaging Het
Vmn2r78 A T 7: 86,921,135 Q287L probably benign Het
Vps13c T A 9: 67,963,089 I3170N probably benign Het
Zfc3h1 T A 10: 115,400,815 M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp773 T C 7: 7,132,908 R230G probably benign Het
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89320998 missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89322750 missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89354888 missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89344096 missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89329556 critical splice donor site probably null
IGL01804:Plxna1 APN 6 89329646 missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89332084 critical splice donor site probably null
IGL01989:Plxna1 APN 6 89329414 nonsense probably null
IGL02015:Plxna1 APN 6 89342451 missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89357332 missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89357269 nonsense probably null
IGL02703:Plxna1 APN 6 89356943 missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89324667 missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89331903 missense probably damaging 1.00
PIT4544001:Plxna1 UTSW 6 89357429 missense probably benign 0.14
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0147:Plxna1 UTSW 6 89320710 missense possibly damaging 0.95
R0149:Plxna1 UTSW 6 89320613 missense probably null 0.95
R0166:Plxna1 UTSW 6 89333019 missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89323593 missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89357336 missense probably benign 0.12
R0841:Plxna1 UTSW 6 89332204 missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89342960 missense probably damaging 1.00
R1240:Plxna1 UTSW 6 89321050 missense probably damaging 1.00
R1355:Plxna1 UTSW 6 89320766 unclassified probably benign
R1700:Plxna1 UTSW 6 89357008 missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89335464 missense probably benign 0.00
R1957:Plxna1 UTSW 6 89331291 missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89324316 missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89342608 missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89356976 missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89357453 missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89334775 unclassified probably benign
R3847:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3872:Plxna1 UTSW 6 89332692 nonsense probably null
R4555:Plxna1 UTSW 6 89323328 missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89334751 missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89322816 missense probably damaging 1.00
R4739:Plxna1 UTSW 6 89332675 splice site probably null
R5053:Plxna1 UTSW 6 89322460 missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89321016 missense probably damaging 1.00
R5449:Plxna1 UTSW 6 89323608 missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89324634 missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89324541 missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89356529 missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89334682 missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89333105 missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89322722 splice site probably benign
R5988:Plxna1 UTSW 6 89357540 nonsense probably null
R6190:Plxna1 UTSW 6 89356604 nonsense probably null
R6425:Plxna1 UTSW 6 89334665 missense probably benign 0.00
R6561:Plxna1 UTSW 6 89356978 missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89322771 missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89324400 missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89319448 missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89320615 missense probably benign 0.01
R6911:Plxna1 UTSW 6 89320974 missense probably damaging 1.00
R7073:Plxna1 UTSW 6 89357329 missense probably damaging 1.00
R7177:Plxna1 UTSW 6 89323329 missense possibly damaging 0.50
R7235:Plxna1 UTSW 6 89340591 missense probably damaging 0.97
R7419:Plxna1 UTSW 6 89357602 missense unknown
R7511:Plxna1 UTSW 6 89341907 missense possibly damaging 0.71
R7543:Plxna1 UTSW 6 89322855 missense probably damaging 1.00
R7665:Plxna1 UTSW 6 89324538 critical splice donor site probably null
R7678:Plxna1 UTSW 6 89331900 missense probably damaging 0.99
R7748:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R7877:Plxna1 UTSW 6 89323259 missense probably damaging 0.99
R8025:Plxna1 UTSW 6 89331272 missense probably damaging 1.00
R8171:Plxna1 UTSW 6 89357120 missense probably benign 0.20
R8277:Plxna1 UTSW 6 89357180 missense probably damaging 1.00
R8782:Plxna1 UTSW 6 89323238 missense probably damaging 1.00
R8867:Plxna1 UTSW 6 89333097 missense probably benign 0.00
R9245:Plxna1 UTSW 6 89337338 missense probably damaging 1.00
R9253:Plxna1 UTSW 6 89357540 nonsense probably null
R9269:Plxna1 UTSW 6 89329559 missense probably null 1.00
R9273:Plxna1 UTSW 6 89319382 missense possibly damaging 0.77
R9281:Plxna1 UTSW 6 89323331 missense probably damaging 1.00
R9368:Plxna1 UTSW 6 89337156 missense probably benign
R9440:Plxna1 UTSW 6 89341930 missense probably benign 0.00
R9526:Plxna1 UTSW 6 89342651 missense probably benign
R9601:Plxna1 UTSW 6 89331271 missense probably damaging 1.00
R9714:Plxna1 UTSW 6 89319458 missense probably damaging 0.99
R9782:Plxna1 UTSW 6 89356835 missense probably benign 0.01
S24628:Plxna1 UTSW 6 89357336 missense probably benign 0.12
V8831:Plxna1 UTSW 6 89357137 missense probably damaging 0.99
Z1176:Plxna1 UTSW 6 89321052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTCACCGAGGAGTTCTGG -3'
(R):5'- AGAGTAAAAGGCTAGCCCCG -3'

Sequencing Primer
(F):5'- AGGAGTTCTGGCACTGCAG -3'
(R):5'- TAAAAGGCTAGCCCCGTGCAG -3'
Posted On 2019-11-26