Incidental Mutation 'R7748:Vps13c'
ID597014
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
SynonymsC230055H22Rik
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7748 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67963089 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 3170 (I3170N)
Ref Sequence ENSEMBL: ENSMUSP00000077040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879]
Predicted Effect probably benign
Transcript: ENSMUST00000077879
AA Change: I3170N

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: I3170N

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,361,792 L103F probably benign Het
4932438A13Rik A G 3: 36,959,335 probably null Het
5330417H12Rik A G 7: 107,624,558 L103P unknown Het
Actb T C 5: 142,904,695 I151V probably benign Het
Adcy6 T A 15: 98,604,556 H59L probably benign Het
Adss G C 1: 177,772,202 S272* probably null Het
Aga A T 8: 53,511,805 M1L possibly damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgap45 A T 10: 80,016,932 probably benign Het
Atp6v0a2 A T 5: 124,716,496 H639L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bod1l A C 5: 41,832,340 S347A probably damaging Het
Calcoco1 T C 15: 102,719,561 D46G probably damaging Het
Camk1 T C 6: 113,340,328 E60G probably damaging Het
Capza1 A T 3: 104,825,405 probably null Het
Ccdc18 T A 5: 108,149,041 probably null Het
Cdh20 G A 1: 104,941,299 A172T probably damaging Het
Cdk4 C T 10: 127,064,429 A65V possibly damaging Het
Cftr T C 6: 18,277,889 probably null Het
Chd3 T C 11: 69,355,633 M1092V probably benign Het
Chd6 A T 2: 160,966,619 H1558Q probably benign Het
Chil1 A G 1: 134,189,228 H318R probably benign Het
Cps1 A G 1: 67,139,806 Y59C probably damaging Het
Cyb5r4 T C 9: 87,032,381 V111A probably damaging Het
D430042O09Rik A T 7: 125,829,801 M558L probably benign Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dhx57 A G 17: 80,265,117 F709S probably damaging Het
Eef1b2 A T 1: 63,177,865 K64N probably damaging Het
Fam135a A G 1: 24,028,969 S940P probably benign Het
Fam234b T A 6: 135,209,351 V119E probably damaging Het
Fbxo46 G C 7: 19,136,533 C359S probably damaging Het
Fkbp14 C A 6: 54,595,520 probably benign Het
Fmn2 T A 1: 174,666,649 V1243E probably damaging Het
Fsbp C A 4: 11,579,924 T64K probably damaging Het
Fscb A T 12: 64,474,407 M95K probably benign Het
Fyb T G 15: 6,638,826 V500G probably damaging Het
G2e3 A G 12: 51,371,667 N615S probably benign Het
Gart T C 16: 91,630,652 D486G possibly damaging Het
Gas2l2 T A 11: 83,422,398 D696V probably benign Het
Glmn C T 5: 107,562,244 probably null Het
Gm47985 A T 1: 151,182,974 D122V probably damaging Het
Gm49333 A T 16: 20,633,084 D407V probably damaging Het
Gm7168 A G 17: 13,948,652 K94E probably benign Het
Gm996 T A 2: 25,578,959 E313D possibly damaging Het
Gnai2 T C 9: 107,615,735 H323R Het
Helz2 C T 2: 181,234,531 R1390H probably damaging Het
Igf2bp1 T C 11: 95,967,587 M453V probably benign Het
Ighv3-1 C T 12: 113,964,650 V30M probably damaging Het
Inpp5a A T 7: 139,574,995 R343S probably damaging Het
Itga8 T A 2: 12,230,239 I403F possibly damaging Het
Krt33a C T 11: 100,011,602 R404H probably benign Het
Krt34 T A 11: 100,038,938 E244V probably damaging Het
Krt42 T C 11: 100,266,966 E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Lama1 T C 17: 67,750,590 L553P Het
Lcn9 T A 2: 25,824,914 *179K probably null Het
Lrrc2 T G 9: 110,980,931 M345R possibly damaging Het
March11 T C 15: 26,387,830 V257A probably damaging Het
Masp2 T C 4: 148,605,706 I224T probably benign Het
Mpz A T 1: 171,159,940 probably null Het
Mtr C T 13: 12,227,839 A442T probably benign Het
Muc5b A G 7: 141,847,805 K596R unknown Het
Myo15 T G 11: 60,504,901 F1397C Het
Ncor2 T C 5: 125,109,967 I173V unknown Het
Ngly1 T A 14: 16,290,820 I434K possibly damaging Het
Notch2 A G 3: 98,138,484 H1655R possibly damaging Het
Notum C T 11: 120,654,801 A390T probably damaging Het
Olfr381 T G 11: 73,486,168 I219L probably benign Het
Olfr519 T C 7: 108,894,078 T115A probably benign Het
Pds5a T A 5: 65,619,666 I51F possibly damaging Het
Pdzd2 C A 15: 12,385,786 R966L possibly damaging Het
Plk3 T C 4: 117,131,728 Y278C probably damaging Het
Plxna1 C G 6: 89,337,352 probably null Het
Plxna1 T A 6: 89,337,353 probably null Het
Ppp4r4 G A 12: 103,605,061 probably null Het
Pramel6 T A 2: 87,508,699 V81E probably damaging Het
Prdm2 T C 4: 143,135,889 E277G possibly damaging Het
Prkg1 T A 19: 30,993,091 I222F possibly damaging Het
Proser3 A T 7: 30,540,072 S536T possibly damaging Het
Prrt4 C A 6: 29,177,191 G193V probably damaging Het
Ptpn21 A T 12: 98,688,772 H645Q probably benign Het
Ptprd T C 4: 76,099,504 I744V probably null Het
Rad54l2 A G 9: 106,719,034 V235A possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs22 C T 15: 36,122,269 probably null Het
Rtcb A T 10: 85,941,968 D447E probably benign Het
Rtn1 C T 12: 72,216,926 V744I possibly damaging Het
Scfd1 T G 12: 51,389,357 I96M probably benign Het
Serpina3b T C 12: 104,130,463 M1T probably null Het
Slc1a4 T C 11: 20,332,252 Y74C probably damaging Het
Slc9b2 A T 3: 135,326,179 I267F possibly damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Sparc T C 11: 55,398,600 I226V probably benign Het
Spata22 T G 11: 73,336,254 I98S probably null Het
Spef2 C T 15: 9,652,945 V917M probably damaging Het
Sspo C A 6: 48,449,465 C139* probably null Het
Tenm4 A G 7: 96,894,702 D2012G probably damaging Het
Tgm5 G A 2: 121,052,808 R351C probably damaging Het
Tmem145 G A 7: 25,307,328 W82* probably null Het
Tmem159 A T 7: 120,115,479 I64F possibly damaging Het
Topors T A 4: 40,262,654 D210V probably damaging Het
Tssk4 A T 14: 55,651,112 H146L probably damaging Het
Unc93b1 T A 19: 3,935,250 D19E unknown Het
Usp17lc A G 7: 103,418,481 T328A probably damaging Het
Utrn A G 10: 12,614,508 Y43H probably benign Het
Vmn1r25 T A 6: 57,978,564 I247F probably damaging Het
Vmn2r78 A T 7: 86,921,135 Q287L probably benign Het
Zfc3h1 T A 10: 115,400,815 M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp773 T C 7: 7,132,908 R230G probably benign Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 intron probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7314:Vps13c UTSW 9 67943340 intron probably null
R7352:Vps13c UTSW 9 67840446 missense possibly damaging 0.94
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7411:Vps13c UTSW 9 67972001 missense probably damaging 0.98
R7497:Vps13c UTSW 9 67840479 missense probably damaging 1.00
R7516:Vps13c UTSW 9 67955007 missense possibly damaging 0.89
R7638:Vps13c UTSW 9 67945509 missense probably damaging 1.00
R7732:Vps13c UTSW 9 67940516 missense probably damaging 0.97
R7779:Vps13c UTSW 9 67881422 missense probably damaging 1.00
R7788:Vps13c UTSW 9 67940483 missense probably benign 0.01
R7894:Vps13c UTSW 9 67926983 missense probably damaging 0.99
R7977:Vps13c UTSW 9 67926983 missense probably damaging 0.99
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGCCTTCATGAGACAGG -3'
(R):5'- AGGCCTTATGCACACTACAC -3'

Sequencing Primer
(F):5'- CTTCATGAGACAGGGACATGACC -3'
(R):5'- TTTTCAAGCTGCACCCCAGAG -3'
Posted On2019-11-26