Incidental Mutation 'R7748:Myo15'
ID597027
Institutional Source Beutler Lab
Gene Symbol Myo15
Ensembl Gene ENSMUSG00000042678
Gene Namemyosin XV
Synonymssh2; sh-2; Myo15a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7748 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location60469339-60528369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 60504901 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 1397 (F1397C)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
Predicted Effect probably benign
Transcript: ENSMUST00000071880
AA Change: F2584C

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: F2584C

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081823
AA Change: F1379C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: F1379C

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094135
AA Change: F2566C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: F2566C

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: F1397C

DomainStartEndE-ValueType
MYSc 34 716 N/A SMART
IQ 717 739 1.63e-1 SMART
IQ 740 762 1.77e-2 SMART
IQ 763 785 2.97e2 SMART
low complexity region 806 820 N/A INTRINSIC
MyTH4 863 1009 1.8e-42 SMART
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1265 1275 N/A INTRINSIC
Blast:MYSc 1479 1662 5e-15 BLAST
SH3 1665 1747 1.55e-4 SMART
low complexity region 1763 1776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,361,792 L103F probably benign Het
4932438A13Rik A G 3: 36,959,335 probably null Het
5330417H12Rik A G 7: 107,624,558 L103P unknown Het
Actb T C 5: 142,904,695 I151V probably benign Het
Adcy6 T A 15: 98,604,556 H59L probably benign Het
Adss G C 1: 177,772,202 S272* probably null Het
Aga A T 8: 53,511,805 M1L possibly damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgap45 A T 10: 80,016,932 probably benign Het
Atp6v0a2 A T 5: 124,716,496 H639L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bod1l A C 5: 41,832,340 S347A probably damaging Het
Calcoco1 T C 15: 102,719,561 D46G probably damaging Het
Camk1 T C 6: 113,340,328 E60G probably damaging Het
Capza1 A T 3: 104,825,405 probably null Het
Ccdc18 T A 5: 108,149,041 probably null Het
Cdh20 G A 1: 104,941,299 A172T probably damaging Het
Cdk4 C T 10: 127,064,429 A65V possibly damaging Het
Cftr T C 6: 18,277,889 probably null Het
Chd3 T C 11: 69,355,633 M1092V probably benign Het
Chd6 A T 2: 160,966,619 H1558Q probably benign Het
Chil1 A G 1: 134,189,228 H318R probably benign Het
Cps1 A G 1: 67,139,806 Y59C probably damaging Het
Cyb5r4 T C 9: 87,032,381 V111A probably damaging Het
D430042O09Rik A T 7: 125,829,801 M558L probably benign Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dhx57 A G 17: 80,265,117 F709S probably damaging Het
Eef1b2 A T 1: 63,177,865 K64N probably damaging Het
Fam135a A G 1: 24,028,969 S940P probably benign Het
Fam234b T A 6: 135,209,351 V119E probably damaging Het
Fbxo46 G C 7: 19,136,533 C359S probably damaging Het
Fkbp14 C A 6: 54,595,520 probably benign Het
Fmn2 T A 1: 174,666,649 V1243E probably damaging Het
Fsbp C A 4: 11,579,924 T64K probably damaging Het
Fscb A T 12: 64,474,407 M95K probably benign Het
Fyb T G 15: 6,638,826 V500G probably damaging Het
G2e3 A G 12: 51,371,667 N615S probably benign Het
Gart T C 16: 91,630,652 D486G possibly damaging Het
Gas2l2 T A 11: 83,422,398 D696V probably benign Het
Glmn C T 5: 107,562,244 probably null Het
Gm47985 A T 1: 151,182,974 D122V probably damaging Het
Gm49333 A T 16: 20,633,084 D407V probably damaging Het
Gm7168 A G 17: 13,948,652 K94E probably benign Het
Gm996 T A 2: 25,578,959 E313D possibly damaging Het
Gnai2 T C 9: 107,615,735 H323R Het
Helz2 C T 2: 181,234,531 R1390H probably damaging Het
Igf2bp1 T C 11: 95,967,587 M453V probably benign Het
Ighv3-1 C T 12: 113,964,650 V30M probably damaging Het
Inpp5a A T 7: 139,574,995 R343S probably damaging Het
Itga8 T A 2: 12,230,239 I403F possibly damaging Het
Krt33a C T 11: 100,011,602 R404H probably benign Het
Krt34 T A 11: 100,038,938 E244V probably damaging Het
Krt42 T C 11: 100,266,966 E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Lama1 T C 17: 67,750,590 L553P Het
Lcn9 T A 2: 25,824,914 *179K probably null Het
Lrrc2 T G 9: 110,980,931 M345R possibly damaging Het
March11 T C 15: 26,387,830 V257A probably damaging Het
Masp2 T C 4: 148,605,706 I224T probably benign Het
Mpz A T 1: 171,159,940 probably null Het
Mtr C T 13: 12,227,839 A442T probably benign Het
Muc5b A G 7: 141,847,805 K596R unknown Het
Ncor2 T C 5: 125,109,967 I173V unknown Het
Ngly1 T A 14: 16,290,820 I434K possibly damaging Het
Notch2 A G 3: 98,138,484 H1655R possibly damaging Het
Notum C T 11: 120,654,801 A390T probably damaging Het
Olfr381 T G 11: 73,486,168 I219L probably benign Het
Olfr519 T C 7: 108,894,078 T115A probably benign Het
Pds5a T A 5: 65,619,666 I51F possibly damaging Het
Pdzd2 C A 15: 12,385,786 R966L possibly damaging Het
Plk3 T C 4: 117,131,728 Y278C probably damaging Het
Plxna1 C G 6: 89,337,352 probably null Het
Plxna1 T A 6: 89,337,353 probably null Het
Ppp4r4 G A 12: 103,605,061 probably null Het
Pramel6 T A 2: 87,508,699 V81E probably damaging Het
Prdm2 T C 4: 143,135,889 E277G possibly damaging Het
Prkg1 T A 19: 30,993,091 I222F possibly damaging Het
Proser3 A T 7: 30,540,072 S536T possibly damaging Het
Prrt4 C A 6: 29,177,191 G193V probably damaging Het
Ptpn21 A T 12: 98,688,772 H645Q probably benign Het
Ptprd T C 4: 76,099,504 I744V probably null Het
Rad54l2 A G 9: 106,719,034 V235A possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs22 C T 15: 36,122,269 probably null Het
Rtcb A T 10: 85,941,968 D447E probably benign Het
Rtn1 C T 12: 72,216,926 V744I possibly damaging Het
Scfd1 T G 12: 51,389,357 I96M probably benign Het
Serpina3b T C 12: 104,130,463 M1T probably null Het
Slc1a4 T C 11: 20,332,252 Y74C probably damaging Het
Slc9b2 A T 3: 135,326,179 I267F possibly damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Sparc T C 11: 55,398,600 I226V probably benign Het
Spata22 T G 11: 73,336,254 I98S probably null Het
Spef2 C T 15: 9,652,945 V917M probably damaging Het
Sspo C A 6: 48,449,465 C139* probably null Het
Tenm4 A G 7: 96,894,702 D2012G probably damaging Het
Tgm5 G A 2: 121,052,808 R351C probably damaging Het
Tmem145 G A 7: 25,307,328 W82* probably null Het
Tmem159 A T 7: 120,115,479 I64F possibly damaging Het
Topors T A 4: 40,262,654 D210V probably damaging Het
Tssk4 A T 14: 55,651,112 H146L probably damaging Het
Unc93b1 T A 19: 3,935,250 D19E unknown Het
Usp17lc A G 7: 103,418,481 T328A probably damaging Het
Utrn A G 10: 12,614,508 Y43H probably benign Het
Vmn1r25 T A 6: 57,978,564 I247F probably damaging Het
Vmn2r78 A T 7: 86,921,135 Q287L probably benign Het
Vps13c T A 9: 67,963,089 I3170N probably benign Het
Zfc3h1 T A 10: 115,400,815 M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp773 T C 7: 7,132,908 R230G probably benign Het
Other mutations in Myo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15 APN 11 60477779 missense probably damaging 1.00
IGL01011:Myo15 APN 11 60476992 missense probably benign 0.33
IGL01100:Myo15 APN 11 60511158 missense probably damaging 1.00
IGL01357:Myo15 APN 11 60502289 splice site probably benign
IGL01634:Myo15 APN 11 60495472 missense probably damaging 1.00
IGL01763:Myo15 APN 11 60521738 missense probably benign 0.07
IGL01901:Myo15 APN 11 60527434 utr 3 prime probably benign
IGL01931:Myo15 APN 11 60496138 missense probably damaging 1.00
IGL02006:Myo15 APN 11 60511128 missense probably damaging 1.00
IGL02041:Myo15 APN 11 60506863 missense probably damaging 0.99
IGL02094:Myo15 APN 11 60510647 unclassified probably benign
IGL02122:Myo15 APN 11 60483466 missense probably benign 0.23
IGL02153:Myo15 APN 11 60498397 missense probably damaging 1.00
IGL02328:Myo15 APN 11 60526607 missense probably benign 0.13
IGL02330:Myo15 APN 11 60477161 missense possibly damaging 0.94
IGL02431:Myo15 APN 11 60510639 missense possibly damaging 0.73
IGL02639:Myo15 APN 11 60478621 missense probably benign
IGL02659:Myo15 APN 11 60491783 splice site probably benign
IGL02800:Myo15 APN 11 60502369 missense probably damaging 1.00
IGL02812:Myo15 APN 11 60477179 missense probably benign 0.15
IGL02863:Myo15 APN 11 60478127 missense probably damaging 1.00
IGL02873:Myo15 APN 11 60483482 missense probably damaging 1.00
IGL02990:Myo15 APN 11 60479440 missense probably benign 0.02
IGL03011:Myo15 APN 11 60509531 splice site probably benign
IGL03243:Myo15 APN 11 60496518 missense probably damaging 1.00
IGL03297:Myo15 APN 11 60479141 missense probably damaging 1.00
parker UTSW 11 60520914 critical splice donor site probably null
Typhoon UTSW 11 60487425 critical splice donor site probably null
PIT4131001:Myo15 UTSW 11 60483127 missense probably damaging 1.00
PIT4131001:Myo15 UTSW 11 60495454 missense probably damaging 1.00
R0133:Myo15 UTSW 11 60477850 missense possibly damaging 0.94
R0265:Myo15 UTSW 11 60514897 critical splice acceptor site probably null
R0389:Myo15 UTSW 11 60478538 missense probably benign
R0416:Myo15 UTSW 11 60511174 missense probably damaging 1.00
R0449:Myo15 UTSW 11 60509596 missense possibly damaging 0.92
R0477:Myo15 UTSW 11 60520914 critical splice donor site probably null
R0543:Myo15 UTSW 11 60479051 missense probably benign
R0546:Myo15 UTSW 11 60506313 missense probably damaging 1.00
R0555:Myo15 UTSW 11 60521638 missense probably damaging 1.00
R0639:Myo15 UTSW 11 60479336 missense probably benign 0.12
R0723:Myo15 UTSW 11 60478977 missense possibly damaging 0.94
R0837:Myo15 UTSW 11 60487251 missense probably damaging 0.98
R0865:Myo15 UTSW 11 60491688 missense probably damaging 1.00
R0899:Myo15 UTSW 11 60477185 missense possibly damaging 0.87
R1022:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1024:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1035:Myo15 UTSW 11 60510558 unclassified probably benign
R1109:Myo15 UTSW 11 60493066 missense probably damaging 1.00
R1170:Myo15 UTSW 11 60479407 missense probably benign 0.04
R1241:Myo15 UTSW 11 60499430 missense possibly damaging 0.58
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1434:Myo15 UTSW 11 60504331 missense probably benign 0.00
R1450:Myo15 UTSW 11 60495482 missense probably damaging 1.00
R1456:Myo15 UTSW 11 60508202 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1548:Myo15 UTSW 11 60488238 missense probably damaging 1.00
R1551:Myo15 UTSW 11 60492965 missense possibly damaging 0.70
R1571:Myo15 UTSW 11 60518464 missense probably damaging 1.00
R1662:Myo15 UTSW 11 60501701 missense probably damaging 1.00
R1777:Myo15 UTSW 11 60514936 missense probably benign
R1778:Myo15 UTSW 11 60478412 missense possibly damaging 0.57
R1847:Myo15 UTSW 11 60499495 nonsense probably null
R1875:Myo15 UTSW 11 60507528 missense probably damaging 0.99
R1944:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R1945:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R2013:Myo15 UTSW 11 60494231 missense probably damaging 1.00
R2107:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2108:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2112:Myo15 UTSW 11 60494168 missense probably damaging 0.99
R2147:Myo15 UTSW 11 60510229 missense possibly damaging 0.66
R2196:Myo15 UTSW 11 60510021 nonsense probably null
R2207:Myo15 UTSW 11 60506034 missense probably benign 0.01
R2245:Myo15 UTSW 11 60509099 missense probably damaging 1.00
R2367:Myo15 UTSW 11 60517238 missense probably damaging 0.99
R2374:Myo15 UTSW 11 60478843 missense possibly damaging 0.88
R2438:Myo15 UTSW 11 60483052 missense probably damaging 1.00
R3154:Myo15 UTSW 11 60479360 splice site probably null
R3423:Myo15 UTSW 11 60510300 critical splice donor site probably null
R3551:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3552:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3612:Myo15 UTSW 11 60477679 missense probably damaging 1.00
R3620:Myo15 UTSW 11 60478642 missense possibly damaging 0.63
R3713:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3714:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3715:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3783:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3784:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3785:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3786:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3787:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3894:Myo15 UTSW 11 60504319 missense probably benign 0.00
R3962:Myo15 UTSW 11 60479828 missense probably benign 0.00
R4082:Myo15 UTSW 11 60487196 missense possibly damaging 0.92
R4555:Myo15 UTSW 11 60496937 missense probably damaging 1.00
R4641:Myo15 UTSW 11 60503041 missense probably damaging 1.00
R4665:Myo15 UTSW 11 60504879 critical splice acceptor site probably null
R4713:Myo15 UTSW 11 60479930 missense probably benign 0.21
R4820:Myo15 UTSW 11 60476915 missense probably damaging 0.98
R5013:Myo15 UTSW 11 60491667 missense probably damaging 1.00
R5051:Myo15 UTSW 11 60487425 critical splice donor site probably null
R5187:Myo15 UTSW 11 60503614 missense probably damaging 1.00
R5230:Myo15 UTSW 11 60502848 missense possibly damaging 0.68
R5277:Myo15 UTSW 11 60477114 nonsense probably null
R5345:Myo15 UTSW 11 60497538 missense probably damaging 0.99
R5349:Myo15 UTSW 11 60493583 missense probably damaging 1.00
R5356:Myo15 UTSW 11 60498366 missense probably damaging 1.00
R5445:Myo15 UTSW 11 60520777 nonsense probably null
R5477:Myo15 UTSW 11 60477677 missense probably damaging 1.00
R5629:Myo15 UTSW 11 60479752 missense probably benign
R5728:Myo15 UTSW 11 60488896 missense probably damaging 1.00
R5818:Myo15 UTSW 11 60497951 missense probably benign 0.06
R5952:Myo15 UTSW 11 60479420 missense possibly damaging 0.50
R6338:Myo15 UTSW 11 60478133 missense probably damaging 0.99
R6467:Myo15 UTSW 11 60526661 critical splice donor site probably null
R6488:Myo15 UTSW 11 60478487 missense possibly damaging 0.86
R6521:Myo15 UTSW 11 60502369 missense probably damaging 1.00
R6645:Myo15 UTSW 11 60477292 missense probably benign 0.00
R6702:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6703:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6821:Myo15 UTSW 11 60524475 missense probably damaging 1.00
R6882:Myo15 UTSW 11 60524006 missense probably damaging 1.00
R6908:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R6932:Myo15 UTSW 11 60499494 missense probably damaging 1.00
R6958:Myo15 UTSW 11 60503625 missense probably benign 0.07
R7041:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R7149:Myo15 UTSW 11 60510010 missense possibly damaging 0.56
R7163:Myo15 UTSW 11 60498369 missense
R7229:Myo15 UTSW 11 60496495 missense probably benign 0.08
R7347:Myo15 UTSW 11 60477961 missense probably benign
R7368:Myo15 UTSW 11 60490915 splice site probably null
R7392:Myo15 UTSW 11 60505976 missense
R7414:Myo15 UTSW 11 60483483 missense
R7461:Myo15 UTSW 11 60505152 missense
R7609:Myo15 UTSW 11 60488811 missense
R7613:Myo15 UTSW 11 60505152 missense
R7734:Myo15 UTSW 11 60510282 missense probably benign
R7767:Myo15 UTSW 11 60502096 missense
R7769:Myo15 UTSW 11 60509149 missense
R7894:Myo15 UTSW 11 60491137 missense
R7919:Myo15 UTSW 11 60526530 missense probably damaging 1.00
R8100:Myo15 UTSW 11 60517190 missense probably damaging 1.00
R8124:Myo15 UTSW 11 60507453 missense
R8129:Myo15 UTSW 11 60508200 missense
R8428:Myo15 UTSW 11 60496415 missense probably damaging 1.00
X0021:Myo15 UTSW 11 60482359 nonsense probably null
X0066:Myo15 UTSW 11 60478220 missense probably damaging 1.00
X0067:Myo15 UTSW 11 60478618 missense possibly damaging 0.88
Z1176:Myo15 UTSW 11 60488258 missense
Z1176:Myo15 UTSW 11 60498403 missense
Z1176:Myo15 UTSW 11 60524441 missense probably damaging 1.00
Z1177:Myo15 UTSW 11 60477523 missense probably damaging 1.00
Z1177:Myo15 UTSW 11 60488837 missense
Z1177:Myo15 UTSW 11 60495475 missense
Predicted Primers PCR Primer
(F):5'- ATCACCACTCAGGATGGTCC -3'
(R):5'- TCACAAAGAGAGCACTCAGG -3'

Sequencing Primer
(F):5'- ATGGTCCCCTGGGCAAC -3'
(R):5'- CTCAGGGAACAGTAAGCAGGCC -3'
Posted On2019-11-26