Incidental Mutation 'R7748:Chd3'
ID597028
Institutional Source Beutler Lab
Gene Symbol Chd3
Ensembl Gene ENSMUSG00000018474
Gene Namechromodomain helicase DNA binding protein 3
SynonymsChd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7748 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69343273-69369406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69355633 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1092 (M1092V)
Ref Sequence ENSEMBL: ENSMUSP00000104301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661]
Predicted Effect probably benign
Transcript: ENSMUST00000092971
AA Change: M1092V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: M1092V

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 199 253 1.4e-34 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1754 1926 8.6e-104 PFAM
low complexity region 1935 1967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108661
AA Change: M1092V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: M1092V

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 200 253 4.3e-29 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1789 1960 4.9e-93 PFAM
low complexity region 1969 2001 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: M998V

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 55 87 N/A INTRINSIC
Pfam:CHDNT 107 160 3.9e-29 PFAM
low complexity region 164 190 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
low complexity region 305 321 N/A INTRINSIC
PHD 341 384 1.54e-14 SMART
RING 342 383 4.25e-1 SMART
PHD 417 460 1.74e-13 SMART
RING 418 459 3.93e0 SMART
CHROMO 465 544 7.23e-14 SMART
CHROMO 588 637 2.85e-12 SMART
low complexity region 656 662 N/A INTRINSIC
DEXDc 691 903 1.64e-31 SMART
low complexity region 1014 1032 N/A INTRINSIC
HELICc 1049 1133 2.61e-25 SMART
low complexity region 1197 1210 N/A INTRINSIC
DUF1087 1252 1316 2.98e-33 SMART
DUF1086 1322 1478 1.79e-109 SMART
low complexity region 1480 1509 N/A INTRINSIC
low complexity region 1579 1592 N/A INTRINSIC
Pfam:CHDCT2 1662 1833 4.4e-93 PFAM
low complexity region 1842 1874 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474
AA Change: M146V

DomainStartEndE-ValueType
Pfam:SNF2_N 1 142 9e-24 PFAM
SCOP:d1gkub2 162 197 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,361,792 L103F probably benign Het
4932438A13Rik A G 3: 36,959,335 probably null Het
5330417H12Rik A G 7: 107,624,558 L103P unknown Het
Actb T C 5: 142,904,695 I151V probably benign Het
Adcy6 T A 15: 98,604,556 H59L probably benign Het
Adss G C 1: 177,772,202 S272* probably null Het
Aga A T 8: 53,511,805 M1L possibly damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgap45 A T 10: 80,016,932 probably benign Het
Atp6v0a2 A T 5: 124,716,496 H639L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bod1l A C 5: 41,832,340 S347A probably damaging Het
Calcoco1 T C 15: 102,719,561 D46G probably damaging Het
Camk1 T C 6: 113,340,328 E60G probably damaging Het
Capza1 A T 3: 104,825,405 probably null Het
Ccdc18 T A 5: 108,149,041 probably null Het
Cdh20 G A 1: 104,941,299 A172T probably damaging Het
Cdk4 C T 10: 127,064,429 A65V possibly damaging Het
Cftr T C 6: 18,277,889 probably null Het
Chd6 A T 2: 160,966,619 H1558Q probably benign Het
Chil1 A G 1: 134,189,228 H318R probably benign Het
Cps1 A G 1: 67,139,806 Y59C probably damaging Het
Cyb5r4 T C 9: 87,032,381 V111A probably damaging Het
D430042O09Rik A T 7: 125,829,801 M558L probably benign Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dhx57 A G 17: 80,265,117 F709S probably damaging Het
Eef1b2 A T 1: 63,177,865 K64N probably damaging Het
Fam135a A G 1: 24,028,969 S940P probably benign Het
Fam234b T A 6: 135,209,351 V119E probably damaging Het
Fbxo46 G C 7: 19,136,533 C359S probably damaging Het
Fkbp14 C A 6: 54,595,520 probably benign Het
Fmn2 T A 1: 174,666,649 V1243E probably damaging Het
Fsbp C A 4: 11,579,924 T64K probably damaging Het
Fscb A T 12: 64,474,407 M95K probably benign Het
Fyb T G 15: 6,638,826 V500G probably damaging Het
G2e3 A G 12: 51,371,667 N615S probably benign Het
Gart T C 16: 91,630,652 D486G possibly damaging Het
Gas2l2 T A 11: 83,422,398 D696V probably benign Het
Glmn C T 5: 107,562,244 probably null Het
Gm47985 A T 1: 151,182,974 D122V probably damaging Het
Gm49333 A T 16: 20,633,084 D407V probably damaging Het
Gm7168 A G 17: 13,948,652 K94E probably benign Het
Gm996 T A 2: 25,578,959 E313D possibly damaging Het
Gnai2 T C 9: 107,615,735 H323R Het
Helz2 C T 2: 181,234,531 R1390H probably damaging Het
Igf2bp1 T C 11: 95,967,587 M453V probably benign Het
Ighv3-1 C T 12: 113,964,650 V30M probably damaging Het
Inpp5a A T 7: 139,574,995 R343S probably damaging Het
Itga8 T A 2: 12,230,239 I403F possibly damaging Het
Krt33a C T 11: 100,011,602 R404H probably benign Het
Krt34 T A 11: 100,038,938 E244V probably damaging Het
Krt42 T C 11: 100,266,966 E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Lama1 T C 17: 67,750,590 L553P Het
Lcn9 T A 2: 25,824,914 *179K probably null Het
Lrrc2 T G 9: 110,980,931 M345R possibly damaging Het
March11 T C 15: 26,387,830 V257A probably damaging Het
Masp2 T C 4: 148,605,706 I224T probably benign Het
Mpz A T 1: 171,159,940 probably null Het
Mtr C T 13: 12,227,839 A442T probably benign Het
Muc5b A G 7: 141,847,805 K596R unknown Het
Myo15 T G 11: 60,504,901 F1397C Het
Ncor2 T C 5: 125,109,967 I173V unknown Het
Ngly1 T A 14: 16,290,820 I434K possibly damaging Het
Notch2 A G 3: 98,138,484 H1655R possibly damaging Het
Notum C T 11: 120,654,801 A390T probably damaging Het
Olfr381 T G 11: 73,486,168 I219L probably benign Het
Olfr519 T C 7: 108,894,078 T115A probably benign Het
Pds5a T A 5: 65,619,666 I51F possibly damaging Het
Pdzd2 C A 15: 12,385,786 R966L possibly damaging Het
Plk3 T C 4: 117,131,728 Y278C probably damaging Het
Plxna1 C G 6: 89,337,352 probably null Het
Plxna1 T A 6: 89,337,353 probably null Het
Ppp4r4 G A 12: 103,605,061 probably null Het
Pramel6 T A 2: 87,508,699 V81E probably damaging Het
Prdm2 T C 4: 143,135,889 E277G possibly damaging Het
Prkg1 T A 19: 30,993,091 I222F possibly damaging Het
Proser3 A T 7: 30,540,072 S536T possibly damaging Het
Prrt4 C A 6: 29,177,191 G193V probably damaging Het
Ptpn21 A T 12: 98,688,772 H645Q probably benign Het
Ptprd T C 4: 76,099,504 I744V probably null Het
Rad54l2 A G 9: 106,719,034 V235A possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs22 C T 15: 36,122,269 probably null Het
Rtcb A T 10: 85,941,968 D447E probably benign Het
Rtn1 C T 12: 72,216,926 V744I possibly damaging Het
Scfd1 T G 12: 51,389,357 I96M probably benign Het
Serpina3b T C 12: 104,130,463 M1T probably null Het
Slc1a4 T C 11: 20,332,252 Y74C probably damaging Het
Slc9b2 A T 3: 135,326,179 I267F possibly damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Sparc T C 11: 55,398,600 I226V probably benign Het
Spata22 T G 11: 73,336,254 I98S probably null Het
Spef2 C T 15: 9,652,945 V917M probably damaging Het
Sspo C A 6: 48,449,465 C139* probably null Het
Tenm4 A G 7: 96,894,702 D2012G probably damaging Het
Tgm5 G A 2: 121,052,808 R351C probably damaging Het
Tmem145 G A 7: 25,307,328 W82* probably null Het
Tmem159 A T 7: 120,115,479 I64F possibly damaging Het
Topors T A 4: 40,262,654 D210V probably damaging Het
Tssk4 A T 14: 55,651,112 H146L probably damaging Het
Unc93b1 T A 19: 3,935,250 D19E unknown Het
Usp17lc A G 7: 103,418,481 T328A probably damaging Het
Utrn A G 10: 12,614,508 Y43H probably benign Het
Vmn1r25 T A 6: 57,978,564 I247F probably damaging Het
Vmn2r78 A T 7: 86,921,135 Q287L probably benign Het
Vps13c T A 9: 67,963,089 I3170N probably benign Het
Zfc3h1 T A 10: 115,400,815 M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp773 T C 7: 7,132,908 R230G probably benign Het
Other mutations in Chd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Chd3 APN 11 69357062 missense probably damaging 0.96
IGL00551:Chd3 APN 11 69346629 missense probably damaging 1.00
IGL00661:Chd3 APN 11 69357383 missense possibly damaging 0.84
IGL00698:Chd3 APN 11 69349871 missense probably damaging 0.98
IGL01075:Chd3 APN 11 69359965 missense probably damaging 1.00
IGL01309:Chd3 APN 11 69357731 missense probably damaging 0.99
IGL01317:Chd3 APN 11 69353211 missense probably damaging 1.00
IGL01374:Chd3 APN 11 69359980 missense probably damaging 0.99
IGL01444:Chd3 APN 11 69348742 missense probably benign 0.28
IGL01617:Chd3 APN 11 69358234 unclassified probably benign
IGL01635:Chd3 APN 11 69361250 splice site probably benign
IGL01942:Chd3 APN 11 69350105 critical splice donor site probably null
IGL01962:Chd3 APN 11 69357493 missense possibly damaging 0.46
IGL01981:Chd3 APN 11 69360675 missense probably damaging 0.99
IGL02022:Chd3 APN 11 69361060 missense probably damaging 1.00
IGL02098:Chd3 APN 11 69359829 missense probably damaging 1.00
IGL02218:Chd3 APN 11 69352094 unclassified probably benign
IGL02415:Chd3 APN 11 69348913 splice site probably benign
IGL02648:Chd3 APN 11 69352150 missense probably damaging 1.00
IGL02951:Chd3 APN 11 69361048 critical splice donor site probably null
IGL03030:Chd3 APN 11 69354404 missense possibly damaging 0.64
IGL03102:Chd3 APN 11 69361196 nonsense probably null
IGL03168:Chd3 APN 11 69348915 splice site probably benign
IGL03327:Chd3 APN 11 69350186 missense probably damaging 1.00
burg UTSW 11 69356554 missense probably damaging 1.00
Fortress UTSW 11 69364050 nonsense probably null
Redoubt UTSW 11 69353901 unclassified probably benign
schloss UTSW 11 69362060 nonsense probably null
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0056:Chd3 UTSW 11 69359913 unclassified probably benign
R0129:Chd3 UTSW 11 69348501 nonsense probably null
R0130:Chd3 UTSW 11 69359830 missense probably damaging 1.00
R0309:Chd3 UTSW 11 69357018 missense probably damaging 1.00
R0330:Chd3 UTSW 11 69356333 missense probably damaging 1.00
R0449:Chd3 UTSW 11 69357541 missense probably damaging 0.98
R0502:Chd3 UTSW 11 69354105 missense probably damaging 0.98
R0540:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0571:Chd3 UTSW 11 69361669 critical splice donor site probably null
R0607:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0616:Chd3 UTSW 11 69345487 missense probably damaging 0.96
R0630:Chd3 UTSW 11 69347195 missense probably damaging 1.00
R1436:Chd3 UTSW 11 69357574 splice site probably null
R1484:Chd3 UTSW 11 69359899 missense probably benign 0.17
R1741:Chd3 UTSW 11 69355654 missense probably damaging 1.00
R1748:Chd3 UTSW 11 69364697 missense possibly damaging 0.81
R1751:Chd3 UTSW 11 69353901 unclassified probably benign
R1833:Chd3 UTSW 11 69354123 missense probably damaging 1.00
R2012:Chd3 UTSW 11 69349052 missense probably benign 0.01
R2101:Chd3 UTSW 11 69349051 missense probably benign
R2147:Chd3 UTSW 11 69349028 missense probably benign 0.00
R2513:Chd3 UTSW 11 69360645 missense probably damaging 1.00
R2877:Chd3 UTSW 11 69361172 nonsense probably null
R2879:Chd3 UTSW 11 69364098 missense possibly damaging 0.52
R2880:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2881:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2973:Chd3 UTSW 11 69360616 missense probably damaging 1.00
R3611:Chd3 UTSW 11 69362147 missense possibly damaging 0.53
R3743:Chd3 UTSW 11 69364050 nonsense probably null
R3845:Chd3 UTSW 11 69346759 missense possibly damaging 0.65
R3889:Chd3 UTSW 11 69359185 missense probably damaging 0.98
R4007:Chd3 UTSW 11 69349001 missense probably benign
R4115:Chd3 UTSW 11 69357517 missense possibly damaging 0.95
R4515:Chd3 UTSW 11 69349877 missense probably benign 0.00
R4612:Chd3 UTSW 11 69353209 nonsense probably null
R4622:Chd3 UTSW 11 69349008 missense probably damaging 0.98
R4634:Chd3 UTSW 11 69362187 unclassified probably benign
R4635:Chd3 UTSW 11 69362187 unclassified probably benign
R4859:Chd3 UTSW 11 69359896 missense possibly damaging 0.79
R4930:Chd3 UTSW 11 69354208 unclassified probably benign
R5173:Chd3 UTSW 11 69369243 unclassified probably benign
R5287:Chd3 UTSW 11 69349069 splice site probably null
R5403:Chd3 UTSW 11 69349069 splice site probably null
R5511:Chd3 UTSW 11 69361475 missense probably damaging 1.00
R5666:Chd3 UTSW 11 69353351 missense possibly damaging 0.83
R5702:Chd3 UTSW 11 69361435 missense possibly damaging 0.46
R6045:Chd3 UTSW 11 69352118 missense possibly damaging 0.90
R6063:Chd3 UTSW 11 69349237 missense probably benign
R6211:Chd3 UTSW 11 69352677 missense probably damaging 1.00
R6215:Chd3 UTSW 11 69356554 missense probably damaging 1.00
R6217:Chd3 UTSW 11 69345535 missense probably damaging 1.00
R6302:Chd3 UTSW 11 69353778 missense probably damaging 0.98
R6329:Chd3 UTSW 11 69361684 missense possibly damaging 0.70
R6349:Chd3 UTSW 11 69364031 missense possibly damaging 0.50
R6414:Chd3 UTSW 11 69352545 critical splice donor site probably null
R6453:Chd3 UTSW 11 69350112 nonsense probably null
R6548:Chd3 UTSW 11 69362060 nonsense probably null
R6582:Chd3 UTSW 11 69369156 unclassified probably benign
R6721:Chd3 UTSW 11 69369219 unclassified probably benign
R6776:Chd3 UTSW 11 69354470 missense probably damaging 1.00
R6900:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
R7085:Chd3 UTSW 11 69369201 missense unknown
R7136:Chd3 UTSW 11 69348438 missense probably null 0.37
R7164:Chd3 UTSW 11 69362306 missense probably damaging 1.00
R7200:Chd3 UTSW 11 69364095 missense possibly damaging 0.94
R7226:Chd3 UTSW 11 69369211 missense unknown
R7238:Chd3 UTSW 11 69364047 missense probably benign 0.31
R7316:Chd3 UTSW 11 69345568 missense probably damaging 0.99
R7560:Chd3 UTSW 11 69356270 missense probably damaging 1.00
R7684:Chd3 UTSW 11 69357866 missense possibly damaging 0.83
R7820:Chd3 UTSW 11 69353238 missense probably damaging 1.00
R7885:Chd3 UTSW 11 69356625 missense probably benign 0.13
R7968:Chd3 UTSW 11 69356625 missense probably benign 0.13
X0022:Chd3 UTSW 11 69356258 missense probably damaging 1.00
X0062:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ACTGGGGAGTTTAGGAGACTCC -3'
(R):5'- GAAATGGTTTCTGCCCACAC -3'

Sequencing Primer
(F):5'- TCCTGAAAGGAGAGGGGTTAG -3'
(R):5'- TCACTTTGTAGACCAGGCAG -3'
Posted On2019-11-26