Mutagenetix > Incidental Mutation

Incidental Mutation 'R7748:Chd3'

597028

Institutional Source

Beutler Lab

Gene Symbol

Chd3

Ensembl Gene

ENSMUSG00000018474

Gene Name

chromodomain helicase DNA binding protein 3

Synonyms

Chd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1

MMRRC Submission

045804-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7748 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69343273-69369406 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69355633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1092 (M1092V)

Ref Sequence

ENSEMBL: ENSMUSP00000104301 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661]

AlphaFold

B1AR17

Predicted Effect

probably benign
Transcript: ENSMUST00000092971
AA Change: M1092V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: M1092V

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	199	253	1.4e-34	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1754	1926	8.6e-104	PFAM
low complexity region	1935	1967	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108661
AA Change: M1092V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: M1092V

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	200	253	4.3e-29	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1789	1960	4.9e-93	PFAM
low complexity region	1969	2001	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: M998V

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	55	87	N/A	INTRINSIC
Pfam:CHDNT	107	160	3.9e-29	PFAM
low complexity region	164	190	N/A	INTRINSIC
low complexity region	192	215	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
low complexity region	274	283	N/A	INTRINSIC
low complexity region	305	321	N/A	INTRINSIC
PHD	341	384	1.54e-14	SMART
RING	342	383	4.25e-1	SMART
PHD	417	460	1.74e-13	SMART
RING	418	459	3.93e0	SMART
CHROMO	465	544	7.23e-14	SMART
CHROMO	588	637	2.85e-12	SMART
low complexity region	656	662	N/A	INTRINSIC
DEXDc	691	903	1.64e-31	SMART
low complexity region	1014	1032	N/A	INTRINSIC
HELICc	1049	1133	2.61e-25	SMART
low complexity region	1197	1210	N/A	INTRINSIC
DUF1087	1252	1316	2.98e-33	SMART
DUF1086	1322	1478	1.79e-109	SMART
low complexity region	1480	1509	N/A	INTRINSIC
low complexity region	1579	1592	N/A	INTRINSIC
Pfam:CHDCT2	1662	1833	4.4e-93	PFAM
low complexity region	1842	1874	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474
AA Change: M146V

Domain	Start	End	E-Value	Type
Pfam:SNF2_N	1	142	9e-24	PFAM
SCOP:d1gkub2	162	197	1e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 111 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	T	A	7: 131,361,792	L103F	probably benign	Het
4932438A13Rik	A	G	3: 36,959,335		probably null	Het
5330417H12Rik	A	G	7: 107,624,558	L103P	unknown	Het
Actb	T	C	5: 142,904,695	I151V	probably benign	Het
Adcy6	T	A	15: 98,604,556	H59L	probably benign	Het
Adss	G	C	1: 177,772,202	S272*	probably null	Het
Aga	A	T	8: 53,511,805	M1L	possibly damaging	Het
Anxa5	G	A	3: 36,465,331	T3M	probably damaging	Het
Arhgap45	A	T	10: 80,016,932		probably benign	Het
Atp6v0a2	A	T	5: 124,716,496	H639L	probably benign	Het
BC005537	C	T	13: 24,803,399	R7W	possibly damaging	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bod1l	A	C	5: 41,832,340	S347A	probably damaging	Het
Calcoco1	T	C	15: 102,719,561	D46G	probably damaging	Het
Camk1	T	C	6: 113,340,328	E60G	probably damaging	Het
Capza1	A	T	3: 104,825,405		probably null	Het
Ccdc18	T	A	5: 108,149,041		probably null	Het
Cdh20	G	A	1: 104,941,299	A172T	probably damaging	Het
Cdk4	C	T	10: 127,064,429	A65V	possibly damaging	Het
Cftr	T	C	6: 18,277,889		probably null	Het
Chd6	A	T	2: 160,966,619	H1558Q	probably benign	Het
Chil1	A	G	1: 134,189,228	H318R	probably benign	Het
Cps1	A	G	1: 67,139,806	Y59C	probably damaging	Het
Cyb5r4	T	C	9: 87,032,381	V111A	probably damaging	Het
D430042O09Rik	A	T	7: 125,829,801	M558L	probably benign	Het
Ddx39b	G	A	17: 35,252,750	V291M	probably damaging	Het
Dhx57	A	G	17: 80,265,117	F709S	probably damaging	Het
Eef1b2	A	T	1: 63,177,865	K64N	probably damaging	Het
Fam135a	A	G	1: 24,028,969	S940P	probably benign	Het
Fam234b	T	A	6: 135,209,351	V119E	probably damaging	Het
Fbxo46	G	C	7: 19,136,533	C359S	probably damaging	Het
Fkbp14	C	A	6: 54,595,520		probably benign	Het
Fmn2	T	A	1: 174,666,649	V1243E	probably damaging	Het
Fsbp	C	A	4: 11,579,924	T64K	probably damaging	Het
Fscb	A	T	12: 64,474,407	M95K	probably benign	Het
Fyb	T	G	15: 6,638,826	V500G	probably damaging	Het
G2e3	A	G	12: 51,371,667	N615S	probably benign	Het
Gart	T	C	16: 91,630,652	D486G	possibly damaging	Het
Gas2l2	T	A	11: 83,422,398	D696V	probably benign	Het
Glmn	C	T	5: 107,562,244		probably null	Het
Gm47985	A	T	1: 151,182,974	D122V	probably damaging	Het
Gm49333	A	T	16: 20,633,084	D407V	probably damaging	Het
Gm7168	A	G	17: 13,948,652	K94E	probably benign	Het
Gm996	T	A	2: 25,578,959	E313D	possibly damaging	Het
Gnai2	T	C	9: 107,615,735	H323R		Het
Helz2	C	T	2: 181,234,531	R1390H	probably damaging	Het
Igf2bp1	T	C	11: 95,967,587	M453V	probably benign	Het
Ighv3-1	C	T	12: 113,964,650	V30M	probably damaging	Het
Inpp5a	A	T	7: 139,574,995	R343S	probably damaging	Het
Itga8	T	A	2: 12,230,239	I403F	possibly damaging	Het
Krt33a	C	T	11: 100,011,602	R404H	probably benign	Het
Krt34	T	A	11: 100,038,938	E244V	probably damaging	Het
Krt42	T	C	11: 100,266,966	E224G	probably damaging	Het
Krtap5-2	TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA	TCCACAGGAACTACA	7: 142,175,108		probably benign	Het
Lama1	T	C	17: 67,750,590	L553P		Het
Lcn9	T	A	2: 25,824,914	*179K	probably null	Het
Lrrc2	T	G	9: 110,980,931	M345R	possibly damaging	Het
March11	T	C	15: 26,387,830	V257A	probably damaging	Het
Masp2	T	C	4: 148,605,706	I224T	probably benign	Het
Mpz	A	T	1: 171,159,940		probably null	Het
Mtr	C	T	13: 12,227,839	A442T	probably benign	Het
Muc5b	A	G	7: 141,847,805	K596R	unknown	Het
Myo15	T	G	11: 60,504,901	F1397C		Het
Ncor2	T	C	5: 125,109,967	I173V	unknown	Het
Ngly1	T	A	14: 16,290,820	I434K	possibly damaging	Het
Notch2	A	G	3: 98,138,484	H1655R	possibly damaging	Het
Notum	C	T	11: 120,654,801	A390T	probably damaging	Het
Olfr381	T	G	11: 73,486,168	I219L	probably benign	Het
Olfr519	T	C	7: 108,894,078	T115A	probably benign	Het
Pds5a	T	A	5: 65,619,666	I51F	possibly damaging	Het
Pdzd2	C	A	15: 12,385,786	R966L	possibly damaging	Het
Plk3	T	C	4: 117,131,728	Y278C	probably damaging	Het
Plxna1	C	G	6: 89,337,352		probably null	Het
Plxna1	T	A	6: 89,337,353		probably null	Het
Ppp4r4	G	A	12: 103,605,061		probably null	Het
Pramel6	T	A	2: 87,508,699	V81E	probably damaging	Het
Prdm2	T	C	4: 143,135,889	E277G	possibly damaging	Het
Prkg1	T	A	19: 30,993,091	I222F	possibly damaging	Het
Proser3	A	T	7: 30,540,072	S536T	possibly damaging	Het
Prrt4	C	A	6: 29,177,191	G193V	probably damaging	Het
Ptpn21	A	T	12: 98,688,772	H645Q	probably benign	Het
Ptprd	T	C	4: 76,099,504	I744V	probably null	Het
Rad54l2	A	G	9: 106,719,034	V235A	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rgs22	C	T	15: 36,122,269		probably null	Het
Rtcb	A	T	10: 85,941,968	D447E	probably benign	Het
Rtn1	C	T	12: 72,216,926	V744I	possibly damaging	Het
Scfd1	T	G	12: 51,389,357	I96M	probably benign	Het
Serpina3b	T	C	12: 104,130,463	M1T	probably null	Het
Slc1a4	T	C	11: 20,332,252	Y74C	probably damaging	Het
Slc9b2	A	T	3: 135,326,179	I267F	possibly damaging	Het
Sorcs2	A	T	5: 36,229,175	M173K	possibly damaging	Het
Sparc	T	C	11: 55,398,600	I226V	probably benign	Het
Spata22	T	G	11: 73,336,254	I98S	probably null	Het
Spef2	C	T	15: 9,652,945	V917M	probably damaging	Het
Sspo	C	A	6: 48,449,465	C139*	probably null	Het
Tenm4	A	G	7: 96,894,702	D2012G	probably damaging	Het
Tgm5	G	A	2: 121,052,808	R351C	probably damaging	Het
Tmem145	G	A	7: 25,307,328	W82*	probably null	Het
Tmem159	A	T	7: 120,115,479	I64F	possibly damaging	Het
Topors	T	A	4: 40,262,654	D210V	probably damaging	Het
Tssk4	A	T	14: 55,651,112	H146L	probably damaging	Het
Unc93b1	T	A	19: 3,935,250	D19E	unknown	Het
Usp17lc	A	G	7: 103,418,481	T328A	probably damaging	Het
Utrn	A	G	10: 12,614,508	Y43H	probably benign	Het
Vmn1r25	T	A	6: 57,978,564	I247F	probably damaging	Het
Vmn2r78	A	T	7: 86,921,135	Q287L	probably benign	Het
Vps13c	T	A	9: 67,963,089	I3170N	probably benign	Het
Zfc3h1	T	A	10: 115,400,815	M398K	probably benign	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp773	T	C	7: 7,132,908	R230G	probably benign	Het

Other mutations in Chd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Chd3	APN	11	69357062	missense	probably damaging	0.96
IGL00551:Chd3	APN	11	69346629	missense	probably damaging	1.00
IGL00661:Chd3	APN	11	69357383	missense	possibly damaging	0.84
IGL00698:Chd3	APN	11	69349871	missense	probably damaging	0.98
IGL01075:Chd3	APN	11	69359965	missense	probably damaging	1.00
IGL01309:Chd3	APN	11	69357731	missense	probably damaging	0.99
IGL01317:Chd3	APN	11	69353211	missense	probably damaging	1.00
IGL01374:Chd3	APN	11	69359980	missense	probably damaging	0.99
IGL01444:Chd3	APN	11	69348742	missense	probably benign	0.28
IGL01617:Chd3	APN	11	69358234	unclassified	probably benign
IGL01635:Chd3	APN	11	69361250	splice site	probably benign
IGL01942:Chd3	APN	11	69350105	critical splice donor site	probably null
IGL01962:Chd3	APN	11	69357493	missense	possibly damaging	0.46
IGL01981:Chd3	APN	11	69360675	missense	probably damaging	0.99
IGL02022:Chd3	APN	11	69361060	missense	probably damaging	1.00
IGL02098:Chd3	APN	11	69359829	missense	probably damaging	1.00
IGL02218:Chd3	APN	11	69352094	unclassified	probably benign
IGL02415:Chd3	APN	11	69348913	splice site	probably benign
IGL02648:Chd3	APN	11	69352150	missense	probably damaging	1.00
IGL02951:Chd3	APN	11	69361048	critical splice donor site	probably null
IGL03030:Chd3	APN	11	69354404	missense	possibly damaging	0.64
IGL03102:Chd3	APN	11	69361196	nonsense	probably null
IGL03168:Chd3	APN	11	69348915	splice site	probably benign
IGL03327:Chd3	APN	11	69350186	missense	probably damaging	1.00
burg	UTSW	11	69356554	missense	probably damaging	1.00
castello	UTSW	11	69355822	critical splice acceptor site	probably benign
feste	UTSW	11	69354426	nonsense	probably null
Fortress	UTSW	11	69364050	nonsense	probably null
moat	UTSW	11	69359185	missense	probably damaging	0.98
Redoubt	UTSW	11	69353901	unclassified	probably benign
schloss	UTSW	11	69362060	nonsense	probably null
siege	UTSW	11	69357018	missense	probably damaging	1.00
R0009:Chd3	UTSW	11	69349906	missense	probably damaging	0.99
R0009:Chd3	UTSW	11	69349906	missense	probably damaging	0.99
R0056:Chd3	UTSW	11	69359913	unclassified	probably benign
R0129:Chd3	UTSW	11	69348501	nonsense	probably null
R0130:Chd3	UTSW	11	69359830	missense	probably damaging	1.00
R0309:Chd3	UTSW	11	69357018	missense	probably damaging	1.00
R0330:Chd3	UTSW	11	69356333	missense	probably damaging	1.00
R0449:Chd3	UTSW	11	69357541	missense	probably damaging	0.98
R0502:Chd3	UTSW	11	69354105	missense	probably damaging	0.98
R0540:Chd3	UTSW	11	69344358	missense	probably damaging	0.98
R0571:Chd3	UTSW	11	69361669	critical splice donor site	probably null
R0607:Chd3	UTSW	11	69344358	missense	probably damaging	0.98
R0616:Chd3	UTSW	11	69345487	missense	probably damaging	0.96
R0630:Chd3	UTSW	11	69347195	missense	probably damaging	1.00
R1436:Chd3	UTSW	11	69357574	splice site	probably null
R1484:Chd3	UTSW	11	69359899	missense	probably benign	0.17
R1741:Chd3	UTSW	11	69355654	missense	probably damaging	1.00
R1748:Chd3	UTSW	11	69364697	missense	possibly damaging	0.81
R1751:Chd3	UTSW	11	69353901	unclassified	probably benign
R1833:Chd3	UTSW	11	69354123	missense	probably damaging	1.00
R2012:Chd3	UTSW	11	69349052	missense	probably benign	0.01
R2101:Chd3	UTSW	11	69349051	missense	probably benign
R2147:Chd3	UTSW	11	69349028	missense	probably benign	0.00
R2513:Chd3	UTSW	11	69360645	missense	probably damaging	1.00
R2877:Chd3	UTSW	11	69361172	nonsense	probably null
R2879:Chd3	UTSW	11	69364098	missense	possibly damaging	0.52
R2880:Chd3	UTSW	11	69352120	missense	probably damaging	1.00
R2881:Chd3	UTSW	11	69352120	missense	probably damaging	1.00
R2973:Chd3	UTSW	11	69360616	missense	probably damaging	1.00
R3611:Chd3	UTSW	11	69362147	missense	possibly damaging	0.53
R3743:Chd3	UTSW	11	69364050	nonsense	probably null
R3845:Chd3	UTSW	11	69346759	missense	possibly damaging	0.65
R3889:Chd3	UTSW	11	69359185	missense	probably damaging	0.98
R4007:Chd3	UTSW	11	69349001	missense	probably benign
R4115:Chd3	UTSW	11	69357517	missense	possibly damaging	0.95
R4515:Chd3	UTSW	11	69349877	missense	probably benign	0.00
R4612:Chd3	UTSW	11	69353209	nonsense	probably null
R4622:Chd3	UTSW	11	69349008	missense	probably damaging	0.98
R4634:Chd3	UTSW	11	69362187	unclassified	probably benign
R4635:Chd3	UTSW	11	69362187	unclassified	probably benign
R4859:Chd3	UTSW	11	69359896	missense	possibly damaging	0.79
R4930:Chd3	UTSW	11	69354208	unclassified	probably benign
R5173:Chd3	UTSW	11	69369243	unclassified	probably benign
R5287:Chd3	UTSW	11	69349069	splice site	probably null
R5403:Chd3	UTSW	11	69349069	splice site	probably null
R5511:Chd3	UTSW	11	69361475	missense	probably damaging	1.00
R5666:Chd3	UTSW	11	69353351	missense	possibly damaging	0.83
R5702:Chd3	UTSW	11	69361435	missense	possibly damaging	0.46
R6045:Chd3	UTSW	11	69352118	missense	possibly damaging	0.90
R6063:Chd3	UTSW	11	69349237	missense	probably benign
R6211:Chd3	UTSW	11	69352677	missense	probably damaging	1.00
R6215:Chd3	UTSW	11	69356554	missense	probably damaging	1.00
R6217:Chd3	UTSW	11	69345535	missense	probably damaging	1.00
R6302:Chd3	UTSW	11	69353778	missense	probably damaging	0.98
R6329:Chd3	UTSW	11	69361684	missense	possibly damaging	0.70
R6349:Chd3	UTSW	11	69364031	missense	possibly damaging	0.50
R6414:Chd3	UTSW	11	69352545	critical splice donor site	probably null
R6453:Chd3	UTSW	11	69350112	nonsense	probably null
R6548:Chd3	UTSW	11	69362060	nonsense	probably null
R6582:Chd3	UTSW	11	69369156	unclassified	probably benign
R6721:Chd3	UTSW	11	69369219	unclassified	probably benign
R6776:Chd3	UTSW	11	69354470	missense	probably damaging	1.00
R6900:Chd3	UTSW	11	69354445	missense	possibly damaging	0.64
R7085:Chd3	UTSW	11	69369201	missense	unknown
R7136:Chd3	UTSW	11	69348438	missense	probably null	0.37
R7164:Chd3	UTSW	11	69362306	missense	probably damaging	1.00
R7200:Chd3	UTSW	11	69364095	missense	possibly damaging	0.94
R7226:Chd3	UTSW	11	69369211	missense	unknown
R7238:Chd3	UTSW	11	69364047	missense	probably benign	0.31
R7316:Chd3	UTSW	11	69345568	missense	probably damaging	0.99
R7560:Chd3	UTSW	11	69356270	missense	probably damaging	1.00
R7684:Chd3	UTSW	11	69357866	missense	possibly damaging	0.83
R7820:Chd3	UTSW	11	69353238	missense	probably damaging	1.00
R7885:Chd3	UTSW	11	69356625	missense	probably benign	0.13
R8150:Chd3	UTSW	11	69363684	missense	probably benign	0.02
R8161:Chd3	UTSW	11	69350885	missense	probably damaging	1.00
R8271:Chd3	UTSW	11	69360657	missense	probably damaging	1.00
R8334:Chd3	UTSW	11	69350796	missense	probably damaging	1.00
R8423:Chd3	UTSW	11	69354426	nonsense	probably null
R8690:Chd3	UTSW	11	69355822	critical splice acceptor site	probably benign
R8828:Chd3	UTSW	11	69356271	missense	probably damaging	1.00
R8857:Chd3	UTSW	11	69362320	missense	probably benign	0.22
R9124:Chd3	UTSW	11	69369336	missense	unknown
R9170:Chd3	UTSW	11	69350822	missense	possibly damaging	0.64
R9213:Chd3	UTSW	11	69364802	missense	possibly damaging	0.53
R9285:Chd3	UTSW	11	69359128	missense	possibly damaging	0.64
R9293:Chd3	UTSW	11	69353201	missense	possibly damaging	0.94
R9368:Chd3	UTSW	11	69360374	missense	probably damaging	1.00
R9521:Chd3	UTSW	11	69358307	missense	probably benign	0.01
R9544:Chd3	UTSW	11	69350220	missense	probably damaging	1.00
R9554:Chd3	UTSW	11	69360189	missense	probably damaging	1.00
R9588:Chd3	UTSW	11	69350220	missense	probably damaging	1.00
X0022:Chd3	UTSW	11	69356258	missense	probably damaging	1.00
X0062:Chd3	UTSW	11	69354445	missense	possibly damaging	0.64
Z1186:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1186:Chd3	UTSW	11	69361451	missense	probably benign
Z1187:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1187:Chd3	UTSW	11	69361451	missense	probably benign
Z1188:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1188:Chd3	UTSW	11	69361451	missense	probably benign
Z1189:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1189:Chd3	UTSW	11	69361451	missense	probably benign
Z1190:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1190:Chd3	UTSW	11	69361451	missense	probably benign
Z1191:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1191:Chd3	UTSW	11	69361451	missense	probably benign
Z1192:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1192:Chd3	UTSW	11	69361451	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTGGGGAGTTTAGGAGACTCC -3'
(R):5'- GAAATGGTTTCTGCCCACAC -3'

Sequencing Primer
(F):5'- TCCTGAAAGGAGAGGGGTTAG -3'
(R):5'- TCACTTTGTAGACCAGGCAG -3'

Posted On

2019-11-26