Incidental Mutation 'R7748:Or1e22'
ID 597030
Institutional Source Beutler Lab
Gene Symbol Or1e22
Ensembl Gene ENSMUSG00000072708
Gene Name olfactory receptor family 1 subfamily E member 22
Synonyms Olfr381, GA_x6K02T2P1NL-3646409-3645474, MOR135-4
MMRRC Submission 045804-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R7748 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 73376713-73377648 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 73376994 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 219 (I219L)
Ref Sequence ENSEMBL: ENSMUSP00000113846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078358] [ENSMUST00000119863] [ENSMUST00000214623] [ENSMUST00000215358]
AlphaFold Q5SSP0
Predicted Effect probably benign
Transcript: ENSMUST00000078358
AA Change: I219L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077467
Gene: ENSMUSG00000072708
AA Change: I219L

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.3e-35 PFAM
Pfam:7tm_4 139 283 5.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119863
AA Change: I219L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113846
Gene: ENSMUSG00000072708
AA Change: I219L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-57 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214623
AA Change: I219L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000215358
AA Change: I219L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 130,963,521 (GRCm39) L103F probably benign Het
5330417H12Rik A G 7: 107,223,765 (GRCm39) L103P unknown Het
Actb T C 5: 142,890,450 (GRCm39) I151V probably benign Het
Adcy6 T A 15: 98,502,437 (GRCm39) H59L probably benign Het
Adss2 G C 1: 177,599,768 (GRCm39) S272* probably null Het
Aga A T 8: 53,964,840 (GRCm39) M1L possibly damaging Het
Ajm1 T A 2: 25,468,971 (GRCm39) E313D possibly damaging Het
Anxa5 G A 3: 36,519,480 (GRCm39) T3M probably damaging Het
Arhgap45 A T 10: 79,852,766 (GRCm39) probably benign Het
Atp6v0a2 A T 5: 124,793,560 (GRCm39) H639L probably benign Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bltp1 A G 3: 37,013,484 (GRCm39) probably null Het
Bod1l A C 5: 41,989,683 (GRCm39) S347A probably damaging Het
Calcoco1 T C 15: 102,627,996 (GRCm39) D46G probably damaging Het
Camk1 T C 6: 113,317,289 (GRCm39) E60G probably damaging Het
Capza1 A T 3: 104,732,721 (GRCm39) probably null Het
Ccdc18 T A 5: 108,296,907 (GRCm39) probably null Het
Cdh20 G A 1: 104,869,024 (GRCm39) A172T probably damaging Het
Cdk4 C T 10: 126,900,298 (GRCm39) A65V possibly damaging Het
Cftr T C 6: 18,277,888 (GRCm39) probably null Het
Chd3 T C 11: 69,246,459 (GRCm39) M1092V probably benign Het
Chd6 A T 2: 160,808,539 (GRCm39) H1558Q probably benign Het
Chi3l1 A G 1: 134,116,966 (GRCm39) H318R probably benign Het
Cps1 A G 1: 67,178,965 (GRCm39) Y59C probably damaging Het
Cyb5r4 T C 9: 86,914,434 (GRCm39) V111A probably damaging Het
Ddx39b G A 17: 35,471,726 (GRCm39) V291M probably damaging Het
Dhx57 A G 17: 80,572,546 (GRCm39) F709S probably damaging Het
Eef1b2 A T 1: 63,217,024 (GRCm39) K64N probably damaging Het
Eef1ece2 A T 16: 20,451,834 (GRCm39) D407V probably damaging Het
Fam135a A G 1: 24,068,050 (GRCm39) S940P probably benign Het
Fam234b T A 6: 135,186,349 (GRCm39) V119E probably damaging Het
Fbxo46 G C 7: 18,870,458 (GRCm39) C359S probably damaging Het
Fkbp14 C A 6: 54,572,505 (GRCm39) probably benign Het
Fmn2 T A 1: 174,494,215 (GRCm39) V1243E probably damaging Het
Fsbp C A 4: 11,579,924 (GRCm39) T64K probably damaging Het
Fscb A T 12: 64,521,181 (GRCm39) M95K probably benign Het
Fyb1 T G 15: 6,668,307 (GRCm39) V500G probably damaging Het
G2e3 A G 12: 51,418,450 (GRCm39) N615S probably benign Het
Gart T C 16: 91,427,540 (GRCm39) D486G possibly damaging Het
Gas2l2 T A 11: 83,313,224 (GRCm39) D696V probably benign Het
Glmn C T 5: 107,710,110 (GRCm39) probably null Het
Gm47985 A T 1: 151,058,725 (GRCm39) D122V probably damaging Het
Gm7168 A G 17: 14,168,914 (GRCm39) K94E probably benign Het
Gnai2 T C 9: 107,492,934 (GRCm39) H323R Het
Helz2 C T 2: 180,876,324 (GRCm39) R1390H probably damaging Het
Igf2bp1 T C 11: 95,858,413 (GRCm39) M453V probably benign Het
Ighv3-1 C T 12: 113,928,270 (GRCm39) V30M probably damaging Het
Inpp5a A T 7: 139,154,911 (GRCm39) R343S probably damaging Het
Itga8 T A 2: 12,235,050 (GRCm39) I403F possibly damaging Het
Katnip A T 7: 125,428,973 (GRCm39) M558L probably benign Het
Krt33a C T 11: 99,902,428 (GRCm39) R404H probably benign Het
Krt34 T A 11: 99,929,764 (GRCm39) E244V probably damaging Het
Krt42 T C 11: 100,157,792 (GRCm39) E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 141,728,845 (GRCm39) probably benign Het
Lama1 T C 17: 68,057,585 (GRCm39) L553P Het
Lcn9 T A 2: 25,714,926 (GRCm39) *179K probably null Het
Ldaf1 A T 7: 119,714,702 (GRCm39) I64F possibly damaging Het
Lrrc2 T G 9: 110,809,999 (GRCm39) M345R possibly damaging Het
Marchf11 T C 15: 26,387,916 (GRCm39) V257A probably damaging Het
Masp2 T C 4: 148,690,163 (GRCm39) I224T probably benign Het
Mpz A T 1: 170,987,509 (GRCm39) probably null Het
Mtr C T 13: 12,242,725 (GRCm39) A442T probably benign Het
Muc5b A G 7: 141,401,542 (GRCm39) K596R unknown Het
Myo15a T G 11: 60,395,727 (GRCm39) F1397C Het
Ncor2 T C 5: 125,187,031 (GRCm39) I173V unknown Het
Ngly1 T A 14: 16,290,820 (GRCm38) I434K possibly damaging Het
Notch2 A G 3: 98,045,800 (GRCm39) H1655R possibly damaging Het
Notum C T 11: 120,545,627 (GRCm39) A390T probably damaging Het
Or10a3n T C 7: 108,493,285 (GRCm39) T115A probably benign Het
Pds5a T A 5: 65,777,009 (GRCm39) I51F possibly damaging Het
Pdzd2 C A 15: 12,385,872 (GRCm39) R966L possibly damaging Het
Plk3 T C 4: 116,988,925 (GRCm39) Y278C probably damaging Het
Plxna1 C G 6: 89,314,334 (GRCm39) probably null Het
Plxna1 T A 6: 89,314,335 (GRCm39) probably null Het
Ppp4r4 G A 12: 103,571,320 (GRCm39) probably null Het
Pramel6 T A 2: 87,339,043 (GRCm39) V81E probably damaging Het
Prdm2 T C 4: 142,862,459 (GRCm39) E277G possibly damaging Het
Prkg1 T A 19: 30,970,491 (GRCm39) I222F possibly damaging Het
Proser3 A T 7: 30,239,497 (GRCm39) S536T possibly damaging Het
Prrt4 C A 6: 29,177,190 (GRCm39) G193V probably damaging Het
Ptpn21 A T 12: 98,655,031 (GRCm39) H645Q probably benign Het
Ptprd T C 4: 76,017,741 (GRCm39) I744V probably null Het
Rad54l2 A G 9: 106,596,233 (GRCm39) V235A possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rgs22 C T 15: 36,122,415 (GRCm39) probably null Het
Rtcb A T 10: 85,777,832 (GRCm39) D447E probably benign Het
Rtn1 C T 12: 72,263,700 (GRCm39) V744I possibly damaging Het
Scfd1 T G 12: 51,436,140 (GRCm39) I96M probably benign Het
Serpina3b T C 12: 104,096,722 (GRCm39) M1T probably null Het
Slc1a4 T C 11: 20,282,252 (GRCm39) Y74C probably damaging Het
Slc9b2 A T 3: 135,031,940 (GRCm39) I267F possibly damaging Het
Sorcs2 A T 5: 36,386,519 (GRCm39) M173K possibly damaging Het
Sparc T C 11: 55,289,426 (GRCm39) I226V probably benign Het
Spata22 T G 11: 73,227,080 (GRCm39) I98S probably null Het
Spef2 C T 15: 9,653,031 (GRCm39) V917M probably damaging Het
Sspo C A 6: 48,426,399 (GRCm39) C139* probably null Het
Tenm4 A G 7: 96,543,909 (GRCm39) D2012G probably damaging Het
Tgm5 G A 2: 120,883,289 (GRCm39) R351C probably damaging Het
Tmem145 G A 7: 25,006,753 (GRCm39) W82* probably null Het
Topors T A 4: 40,262,654 (GRCm39) D210V probably damaging Het
Tssk4 A T 14: 55,888,569 (GRCm39) H146L probably damaging Het
Unc93b1 T A 19: 3,985,250 (GRCm39) D19E unknown Het
Usp17lc A G 7: 103,067,688 (GRCm39) T328A probably damaging Het
Utrn A G 10: 12,490,252 (GRCm39) Y43H probably benign Het
Vmn1r25 T A 6: 57,955,549 (GRCm39) I247F probably damaging Het
Vmn2r78 A T 7: 86,570,343 (GRCm39) Q287L probably benign Het
Vps13c T A 9: 67,870,371 (GRCm39) I3170N probably benign Het
Zfc3h1 T A 10: 115,236,720 (GRCm39) M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp773 T C 7: 7,135,907 (GRCm39) R230G probably benign Het
Other mutations in Or1e22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Or1e22 APN 11 73,377,398 (GRCm39) missense probably benign 0.22
IGL02867:Or1e22 APN 11 73,376,817 (GRCm39) missense probably damaging 1.00
IGL03202:Or1e22 APN 11 73,377,351 (GRCm39) nonsense probably null
R0207:Or1e22 UTSW 11 73,377,401 (GRCm39) missense probably benign 0.00
R0539:Or1e22 UTSW 11 73,376,889 (GRCm39) missense probably benign 0.22
R1469:Or1e22 UTSW 11 73,377,149 (GRCm39) missense possibly damaging 0.81
R1469:Or1e22 UTSW 11 73,377,149 (GRCm39) missense possibly damaging 0.81
R1835:Or1e22 UTSW 11 73,377,200 (GRCm39) missense probably benign 0.08
R2095:Or1e22 UTSW 11 73,377,420 (GRCm39) missense probably damaging 1.00
R3612:Or1e22 UTSW 11 73,376,766 (GRCm39) missense probably benign 0.23
R3983:Or1e22 UTSW 11 73,376,961 (GRCm39) missense possibly damaging 0.84
R4959:Or1e22 UTSW 11 73,376,893 (GRCm39) nonsense probably null
R4983:Or1e22 UTSW 11 73,377,623 (GRCm39) missense probably benign 0.04
R5297:Or1e22 UTSW 11 73,377,215 (GRCm39) missense probably damaging 0.99
R5447:Or1e22 UTSW 11 73,377,002 (GRCm39) missense probably benign 0.01
R5569:Or1e22 UTSW 11 73,377,518 (GRCm39) missense probably damaging 0.97
R5580:Or1e22 UTSW 11 73,377,036 (GRCm39) missense probably benign
R5711:Or1e22 UTSW 11 73,377,008 (GRCm39) missense probably damaging 1.00
R5810:Or1e22 UTSW 11 73,376,921 (GRCm39) nonsense probably null
R6974:Or1e22 UTSW 11 73,377,299 (GRCm39) missense probably benign 0.00
R7383:Or1e22 UTSW 11 73,376,715 (GRCm39) makesense probably null
R7661:Or1e22 UTSW 11 73,377,426 (GRCm39) missense probably damaging 1.00
R7913:Or1e22 UTSW 11 73,377,224 (GRCm39) missense probably benign 0.01
R9400:Or1e22 UTSW 11 73,376,807 (GRCm39) missense probably damaging 1.00
R9666:Or1e22 UTSW 11 73,376,885 (GRCm39) missense probably damaging 0.98
Z1177:Or1e22 UTSW 11 73,376,979 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTCAGCATGGGAGTCACCAC -3'
(R):5'- GTATGCTGTATTCCATGTTGCAC -3'

Sequencing Primer
(F):5'- GAGTCACCACTGTGTACATCATGG -3'
(R):5'- GCACACTCTACTCTTGGCTAGATTG -3'
Posted On 2019-11-26