Incidental Mutation 'R0632:Vmn2r59'
ID 59704
Institutional Source Beutler Lab
Gene Symbol Vmn2r59
Ensembl Gene ENSMUSG00000092032
Gene Name vomeronasal 2, receptor 59
Synonyms EG628444
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R0632 (G1)
Quality Score 221
Status Validated
Chromosome 7
Chromosomal Location 41661216-41708405 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41708308 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 33 (Y33C)
Ref Sequence ENSEMBL: ENSMUSP00000131856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168489]
AlphaFold E9PUT5
Predicted Effect probably damaging
Transcript: ENSMUST00000168489
AA Change: Y33C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131856
Gene: ENSMUSG00000092032
AA Change: Y33C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-44 PFAM
Pfam:NCD3G 514 567 4.3e-23 PFAM
Pfam:7tm_3 600 835 5.4e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Vmn2r59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r59 APN 7 41,661,488 (GRCm39) missense possibly damaging 0.91
IGL01432:Vmn2r59 APN 7 41,661,983 (GRCm39) missense possibly damaging 0.82
IGL02119:Vmn2r59 APN 7 41,695,593 (GRCm39) missense probably benign 0.36
IGL02216:Vmn2r59 APN 7 41,661,817 (GRCm39) missense probably damaging 1.00
IGL02327:Vmn2r59 APN 7 41,661,655 (GRCm39) missense probably benign
IGL03346:Vmn2r59 APN 7 41,693,253 (GRCm39) missense probably benign 0.00
IGL03411:Vmn2r59 APN 7 41,708,340 (GRCm39) missense probably benign 0.43
IGL03412:Vmn2r59 APN 7 41,661,862 (GRCm39) missense probably benign
PIT4366001:Vmn2r59 UTSW 7 41,695,205 (GRCm39) missense possibly damaging 0.91
R0068:Vmn2r59 UTSW 7 41,695,725 (GRCm39) missense probably damaging 0.99
R0094:Vmn2r59 UTSW 7 41,661,722 (GRCm39) missense probably benign 0.07
R0179:Vmn2r59 UTSW 7 41,696,432 (GRCm39) nonsense probably null
R0370:Vmn2r59 UTSW 7 41,662,150 (GRCm39) missense probably benign 0.23
R0412:Vmn2r59 UTSW 7 41,695,916 (GRCm39) splice site probably benign
R0465:Vmn2r59 UTSW 7 41,696,332 (GRCm39) missense probably benign
R0487:Vmn2r59 UTSW 7 41,696,528 (GRCm39) nonsense probably null
R0576:Vmn2r59 UTSW 7 41,696,529 (GRCm39) missense probably benign 0.01
R1356:Vmn2r59 UTSW 7 41,661,218 (GRCm39) makesense probably null
R1387:Vmn2r59 UTSW 7 41,695,521 (GRCm39) missense probably damaging 1.00
R1388:Vmn2r59 UTSW 7 41,695,133 (GRCm39) missense probably benign 0.01
R1435:Vmn2r59 UTSW 7 41,695,629 (GRCm39) missense possibly damaging 0.50
R1750:Vmn2r59 UTSW 7 41,695,251 (GRCm39) missense possibly damaging 0.50
R2020:Vmn2r59 UTSW 7 41,693,203 (GRCm39) missense probably damaging 1.00
R2249:Vmn2r59 UTSW 7 41,708,326 (GRCm39) missense probably benign 0.00
R2256:Vmn2r59 UTSW 7 41,661,669 (GRCm39) nonsense probably null
R2257:Vmn2r59 UTSW 7 41,661,669 (GRCm39) nonsense probably null
R2441:Vmn2r59 UTSW 7 41,695,570 (GRCm39) missense probably benign 0.00
R2511:Vmn2r59 UTSW 7 41,693,190 (GRCm39) missense probably damaging 1.00
R2860:Vmn2r59 UTSW 7 41,696,427 (GRCm39) missense possibly damaging 0.79
R2861:Vmn2r59 UTSW 7 41,696,427 (GRCm39) missense possibly damaging 0.79
R3690:Vmn2r59 UTSW 7 41,661,370 (GRCm39) missense possibly damaging 0.77
R3912:Vmn2r59 UTSW 7 41,695,744 (GRCm39) missense probably benign 0.00
R4167:Vmn2r59 UTSW 7 41,670,732 (GRCm39) intron probably benign
R4357:Vmn2r59 UTSW 7 41,661,644 (GRCm39) missense probably damaging 1.00
R4445:Vmn2r59 UTSW 7 41,691,874 (GRCm39) missense probably damaging 1.00
R4542:Vmn2r59 UTSW 7 41,695,497 (GRCm39) missense possibly damaging 0.93
R4587:Vmn2r59 UTSW 7 41,695,648 (GRCm39) missense probably benign 0.00
R4616:Vmn2r59 UTSW 7 41,661,862 (GRCm39) missense probably benign
R4653:Vmn2r59 UTSW 7 41,693,228 (GRCm39) missense probably benign 0.19
R4703:Vmn2r59 UTSW 7 41,661,686 (GRCm39) missense probably benign 0.01
R4895:Vmn2r59 UTSW 7 41,695,218 (GRCm39) missense probably damaging 0.98
R4910:Vmn2r59 UTSW 7 41,693,077 (GRCm39) missense probably benign
R5045:Vmn2r59 UTSW 7 41,695,496 (GRCm39) missense possibly damaging 0.93
R5105:Vmn2r59 UTSW 7 41,696,529 (GRCm39) missense probably benign 0.01
R5153:Vmn2r59 UTSW 7 41,691,834 (GRCm39) critical splice donor site probably null
R5566:Vmn2r59 UTSW 7 41,696,247 (GRCm39) missense possibly damaging 0.92
R5586:Vmn2r59 UTSW 7 41,695,105 (GRCm39) missense probably benign 0.12
R5606:Vmn2r59 UTSW 7 41,695,318 (GRCm39) missense probably benign 0.27
R5616:Vmn2r59 UTSW 7 41,708,191 (GRCm39) splice site probably null
R5625:Vmn2r59 UTSW 7 41,695,884 (GRCm39) missense probably benign 0.03
R5696:Vmn2r59 UTSW 7 41,695,468 (GRCm39) missense probably benign 0.00
R5982:Vmn2r59 UTSW 7 41,695,491 (GRCm39) missense probably benign 0.00
R6106:Vmn2r59 UTSW 7 41,661,749 (GRCm39) nonsense probably null
R6196:Vmn2r59 UTSW 7 41,661,679 (GRCm39) missense probably benign 0.36
R6228:Vmn2r59 UTSW 7 41,691,835 (GRCm39) critical splice donor site probably null
R6590:Vmn2r59 UTSW 7 41,695,890 (GRCm39) missense probably damaging 1.00
R6625:Vmn2r59 UTSW 7 41,693,177 (GRCm39) missense probably benign 0.02
R6690:Vmn2r59 UTSW 7 41,695,890 (GRCm39) missense probably damaging 1.00
R6768:Vmn2r59 UTSW 7 41,661,392 (GRCm39) missense probably benign 0.17
R6830:Vmn2r59 UTSW 7 41,693,171 (GRCm39) missense probably benign 0.10
R6859:Vmn2r59 UTSW 7 41,693,277 (GRCm39) missense probably damaging 1.00
R7034:Vmn2r59 UTSW 7 41,695,644 (GRCm39) missense probably benign 0.03
R7036:Vmn2r59 UTSW 7 41,695,644 (GRCm39) missense probably benign 0.03
R7145:Vmn2r59 UTSW 7 41,695,188 (GRCm39) missense probably damaging 1.00
R7556:Vmn2r59 UTSW 7 41,695,233 (GRCm39) missense probably damaging 1.00
R7733:Vmn2r59 UTSW 7 41,661,443 (GRCm39) missense probably benign 0.17
R7770:Vmn2r59 UTSW 7 41,708,336 (GRCm39) missense probably damaging 1.00
R7812:Vmn2r59 UTSW 7 41,695,196 (GRCm39) nonsense probably null
R7867:Vmn2r59 UTSW 7 41,661,707 (GRCm39) missense probably damaging 1.00
R7975:Vmn2r59 UTSW 7 41,693,199 (GRCm39) missense probably damaging 1.00
R7999:Vmn2r59 UTSW 7 41,696,256 (GRCm39) missense probably damaging 1.00
R8267:Vmn2r59 UTSW 7 41,661,521 (GRCm39) missense probably damaging 0.97
R8367:Vmn2r59 UTSW 7 41,661,247 (GRCm39) missense probably benign 0.44
R9106:Vmn2r59 UTSW 7 41,695,884 (GRCm39) missense probably benign 0.03
R9135:Vmn2r59 UTSW 7 41,693,127 (GRCm39) missense
R9135:Vmn2r59 UTSW 7 41,693,125 (GRCm39) missense probably benign 0.33
R9234:Vmn2r59 UTSW 7 41,661,907 (GRCm39) missense possibly damaging 0.67
R9273:Vmn2r59 UTSW 7 41,695,286 (GRCm39) nonsense probably null
R9432:Vmn2r59 UTSW 7 41,696,254 (GRCm39) missense probably damaging 1.00
R9433:Vmn2r59 UTSW 7 41,695,590 (GRCm39) missense probably damaging 0.99
R9616:Vmn2r59 UTSW 7 41,661,299 (GRCm39) missense probably damaging 1.00
R9654:Vmn2r59 UTSW 7 41,693,217 (GRCm39) missense probably benign 0.10
R9741:Vmn2r59 UTSW 7 41,708,209 (GRCm39) missense probably damaging 0.99
X0025:Vmn2r59 UTSW 7 41,695,365 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r59 UTSW 7 41,661,838 (GRCm39) missense possibly damaging 0.85
Z1176:Vmn2r59 UTSW 7 41,691,941 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTCAGTTGTCTATCCACTCAGTTAC -3'
(R):5'- GCTGCACTCATTAACAGTCAGAAGCAC -3'

Sequencing Primer
(F):5'- CCCAGAAGTTCAAGGTAATACTTAG -3'
(R):5'- GTCAGAAGCACAAAATGTTCAC -3'
Posted On 2013-07-11