Incidental Mutation 'R7748:Ppp4r4'
ID 597042
Institutional Source Beutler Lab
Gene Symbol Ppp4r4
Ensembl Gene ENSMUSG00000021209
Gene Name protein phosphatase 4, regulatory subunit 4
Synonyms 8430415E04Rik
MMRRC Submission 045804-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R7748 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 103498542-103580090 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 103571320 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021631] [ENSMUST00000187155] [ENSMUST00000189871] [ENSMUST00000190151]
AlphaFold Q8C0Y0
Predicted Effect probably null
Transcript: ENSMUST00000021631
SMART Domains Protein: ENSMUSP00000021631
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
SCOP:d1gw5a_ 55 577 6e-27 SMART
PDB:3FGA|A 178 666 8e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187155
SMART Domains Protein: ENSMUSP00000140874
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
Pfam:HEAT 145 175 2.8e-3 PFAM
low complexity region 484 495 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189871
SMART Domains Protein: ENSMUSP00000139786
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
SCOP:d1gw5a_ 95 577 7e-26 SMART
PDB:1B3U|B 178 666 2e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190151
SMART Domains Protein: ENSMUSP00000139815
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
low complexity region 99 114 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 130,963,521 (GRCm39) L103F probably benign Het
5330417H12Rik A G 7: 107,223,765 (GRCm39) L103P unknown Het
Actb T C 5: 142,890,450 (GRCm39) I151V probably benign Het
Adcy6 T A 15: 98,502,437 (GRCm39) H59L probably benign Het
Adss2 G C 1: 177,599,768 (GRCm39) S272* probably null Het
Aga A T 8: 53,964,840 (GRCm39) M1L possibly damaging Het
Ajm1 T A 2: 25,468,971 (GRCm39) E313D possibly damaging Het
Anxa5 G A 3: 36,519,480 (GRCm39) T3M probably damaging Het
Arhgap45 A T 10: 79,852,766 (GRCm39) probably benign Het
Atp6v0a2 A T 5: 124,793,560 (GRCm39) H639L probably benign Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bltp1 A G 3: 37,013,484 (GRCm39) probably null Het
Bod1l A C 5: 41,989,683 (GRCm39) S347A probably damaging Het
Calcoco1 T C 15: 102,627,996 (GRCm39) D46G probably damaging Het
Camk1 T C 6: 113,317,289 (GRCm39) E60G probably damaging Het
Capza1 A T 3: 104,732,721 (GRCm39) probably null Het
Ccdc18 T A 5: 108,296,907 (GRCm39) probably null Het
Cdh20 G A 1: 104,869,024 (GRCm39) A172T probably damaging Het
Cdk4 C T 10: 126,900,298 (GRCm39) A65V possibly damaging Het
Cftr T C 6: 18,277,888 (GRCm39) probably null Het
Chd3 T C 11: 69,246,459 (GRCm39) M1092V probably benign Het
Chd6 A T 2: 160,808,539 (GRCm39) H1558Q probably benign Het
Chi3l1 A G 1: 134,116,966 (GRCm39) H318R probably benign Het
Cps1 A G 1: 67,178,965 (GRCm39) Y59C probably damaging Het
Cyb5r4 T C 9: 86,914,434 (GRCm39) V111A probably damaging Het
Ddx39b G A 17: 35,471,726 (GRCm39) V291M probably damaging Het
Dhx57 A G 17: 80,572,546 (GRCm39) F709S probably damaging Het
Eef1b2 A T 1: 63,217,024 (GRCm39) K64N probably damaging Het
Eef1ece2 A T 16: 20,451,834 (GRCm39) D407V probably damaging Het
Fam135a A G 1: 24,068,050 (GRCm39) S940P probably benign Het
Fam234b T A 6: 135,186,349 (GRCm39) V119E probably damaging Het
Fbxo46 G C 7: 18,870,458 (GRCm39) C359S probably damaging Het
Fkbp14 C A 6: 54,572,505 (GRCm39) probably benign Het
Fmn2 T A 1: 174,494,215 (GRCm39) V1243E probably damaging Het
Fsbp C A 4: 11,579,924 (GRCm39) T64K probably damaging Het
Fscb A T 12: 64,521,181 (GRCm39) M95K probably benign Het
Fyb1 T G 15: 6,668,307 (GRCm39) V500G probably damaging Het
G2e3 A G 12: 51,418,450 (GRCm39) N615S probably benign Het
Gart T C 16: 91,427,540 (GRCm39) D486G possibly damaging Het
Gas2l2 T A 11: 83,313,224 (GRCm39) D696V probably benign Het
Glmn C T 5: 107,710,110 (GRCm39) probably null Het
Gm47985 A T 1: 151,058,725 (GRCm39) D122V probably damaging Het
Gm7168 A G 17: 14,168,914 (GRCm39) K94E probably benign Het
Gnai2 T C 9: 107,492,934 (GRCm39) H323R Het
Helz2 C T 2: 180,876,324 (GRCm39) R1390H probably damaging Het
Igf2bp1 T C 11: 95,858,413 (GRCm39) M453V probably benign Het
Ighv3-1 C T 12: 113,928,270 (GRCm39) V30M probably damaging Het
Inpp5a A T 7: 139,154,911 (GRCm39) R343S probably damaging Het
Itga8 T A 2: 12,235,050 (GRCm39) I403F possibly damaging Het
Katnip A T 7: 125,428,973 (GRCm39) M558L probably benign Het
Krt33a C T 11: 99,902,428 (GRCm39) R404H probably benign Het
Krt34 T A 11: 99,929,764 (GRCm39) E244V probably damaging Het
Krt42 T C 11: 100,157,792 (GRCm39) E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 141,728,845 (GRCm39) probably benign Het
Lama1 T C 17: 68,057,585 (GRCm39) L553P Het
Lcn9 T A 2: 25,714,926 (GRCm39) *179K probably null Het
Ldaf1 A T 7: 119,714,702 (GRCm39) I64F possibly damaging Het
Lrrc2 T G 9: 110,809,999 (GRCm39) M345R possibly damaging Het
Marchf11 T C 15: 26,387,916 (GRCm39) V257A probably damaging Het
Masp2 T C 4: 148,690,163 (GRCm39) I224T probably benign Het
Mpz A T 1: 170,987,509 (GRCm39) probably null Het
Mtr C T 13: 12,242,725 (GRCm39) A442T probably benign Het
Muc5b A G 7: 141,401,542 (GRCm39) K596R unknown Het
Myo15a T G 11: 60,395,727 (GRCm39) F1397C Het
Ncor2 T C 5: 125,187,031 (GRCm39) I173V unknown Het
Ngly1 T A 14: 16,290,820 (GRCm38) I434K possibly damaging Het
Notch2 A G 3: 98,045,800 (GRCm39) H1655R possibly damaging Het
Notum C T 11: 120,545,627 (GRCm39) A390T probably damaging Het
Or10a3n T C 7: 108,493,285 (GRCm39) T115A probably benign Het
Or1e22 T G 11: 73,376,994 (GRCm39) I219L probably benign Het
Pds5a T A 5: 65,777,009 (GRCm39) I51F possibly damaging Het
Pdzd2 C A 15: 12,385,872 (GRCm39) R966L possibly damaging Het
Plk3 T C 4: 116,988,925 (GRCm39) Y278C probably damaging Het
Plxna1 C G 6: 89,314,334 (GRCm39) probably null Het
Plxna1 T A 6: 89,314,335 (GRCm39) probably null Het
Pramel6 T A 2: 87,339,043 (GRCm39) V81E probably damaging Het
Prdm2 T C 4: 142,862,459 (GRCm39) E277G possibly damaging Het
Prkg1 T A 19: 30,970,491 (GRCm39) I222F possibly damaging Het
Proser3 A T 7: 30,239,497 (GRCm39) S536T possibly damaging Het
Prrt4 C A 6: 29,177,190 (GRCm39) G193V probably damaging Het
Ptpn21 A T 12: 98,655,031 (GRCm39) H645Q probably benign Het
Ptprd T C 4: 76,017,741 (GRCm39) I744V probably null Het
Rad54l2 A G 9: 106,596,233 (GRCm39) V235A possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rgs22 C T 15: 36,122,415 (GRCm39) probably null Het
Rtcb A T 10: 85,777,832 (GRCm39) D447E probably benign Het
Rtn1 C T 12: 72,263,700 (GRCm39) V744I possibly damaging Het
Scfd1 T G 12: 51,436,140 (GRCm39) I96M probably benign Het
Serpina3b T C 12: 104,096,722 (GRCm39) M1T probably null Het
Slc1a4 T C 11: 20,282,252 (GRCm39) Y74C probably damaging Het
Slc9b2 A T 3: 135,031,940 (GRCm39) I267F possibly damaging Het
Sorcs2 A T 5: 36,386,519 (GRCm39) M173K possibly damaging Het
Sparc T C 11: 55,289,426 (GRCm39) I226V probably benign Het
Spata22 T G 11: 73,227,080 (GRCm39) I98S probably null Het
Spef2 C T 15: 9,653,031 (GRCm39) V917M probably damaging Het
Sspo C A 6: 48,426,399 (GRCm39) C139* probably null Het
Tenm4 A G 7: 96,543,909 (GRCm39) D2012G probably damaging Het
Tgm5 G A 2: 120,883,289 (GRCm39) R351C probably damaging Het
Tmem145 G A 7: 25,006,753 (GRCm39) W82* probably null Het
Topors T A 4: 40,262,654 (GRCm39) D210V probably damaging Het
Tssk4 A T 14: 55,888,569 (GRCm39) H146L probably damaging Het
Unc93b1 T A 19: 3,985,250 (GRCm39) D19E unknown Het
Usp17lc A G 7: 103,067,688 (GRCm39) T328A probably damaging Het
Utrn A G 10: 12,490,252 (GRCm39) Y43H probably benign Het
Vmn1r25 T A 6: 57,955,549 (GRCm39) I247F probably damaging Het
Vmn2r78 A T 7: 86,570,343 (GRCm39) Q287L probably benign Het
Vps13c T A 9: 67,870,371 (GRCm39) I3170N probably benign Het
Zfc3h1 T A 10: 115,236,720 (GRCm39) M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp773 T C 7: 7,135,907 (GRCm39) R230G probably benign Het
Other mutations in Ppp4r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Ppp4r4 APN 12 103,545,335 (GRCm39) missense probably benign
IGL01388:Ppp4r4 APN 12 103,543,108 (GRCm39) missense probably damaging 1.00
IGL01662:Ppp4r4 APN 12 103,569,225 (GRCm39) missense possibly damaging 0.55
IGL01768:Ppp4r4 APN 12 103,547,664 (GRCm39) missense probably benign 0.12
IGL01894:Ppp4r4 APN 12 103,559,397 (GRCm39) missense probably damaging 1.00
IGL01921:Ppp4r4 APN 12 103,542,569 (GRCm39) start codon destroyed probably null 0.01
IGL01960:Ppp4r4 APN 12 103,547,753 (GRCm39) splice site probably benign
IGL02084:Ppp4r4 APN 12 103,566,657 (GRCm39) missense possibly damaging 0.93
IGL02287:Ppp4r4 APN 12 103,553,747 (GRCm39) missense probably benign 0.01
IGL02315:Ppp4r4 APN 12 103,566,620 (GRCm39) splice site probably benign
IGL03137:Ppp4r4 APN 12 103,547,643 (GRCm39) missense probably damaging 1.00
IGL03170:Ppp4r4 APN 12 103,557,033 (GRCm39) intron probably benign
cataract UTSW 12 103,579,074 (GRCm39) nonsense probably null
downfall UTSW 12 103,559,357 (GRCm39) missense probably benign 0.00
R0114:Ppp4r4 UTSW 12 103,542,633 (GRCm39) missense probably benign 0.00
R0390:Ppp4r4 UTSW 12 103,567,619 (GRCm39) splice site probably benign
R0403:Ppp4r4 UTSW 12 103,550,361 (GRCm39) missense probably benign
R0548:Ppp4r4 UTSW 12 103,579,074 (GRCm39) nonsense probably null
R0601:Ppp4r4 UTSW 12 103,566,779 (GRCm39) splice site probably benign
R0894:Ppp4r4 UTSW 12 103,566,754 (GRCm39) missense probably damaging 0.99
R1127:Ppp4r4 UTSW 12 103,545,327 (GRCm39) missense probably damaging 1.00
R1177:Ppp4r4 UTSW 12 103,542,582 (GRCm39) missense possibly damaging 0.82
R1378:Ppp4r4 UTSW 12 103,547,751 (GRCm39) splice site probably benign
R1442:Ppp4r4 UTSW 12 103,564,504 (GRCm39) missense probably damaging 0.97
R1497:Ppp4r4 UTSW 12 103,573,204 (GRCm39) missense probably benign 0.07
R1651:Ppp4r4 UTSW 12 103,550,331 (GRCm39) missense probably benign 0.01
R1797:Ppp4r4 UTSW 12 103,564,410 (GRCm39) missense possibly damaging 0.95
R1880:Ppp4r4 UTSW 12 103,571,294 (GRCm39) missense possibly damaging 0.62
R2008:Ppp4r4 UTSW 12 103,552,016 (GRCm39) missense probably damaging 1.00
R2038:Ppp4r4 UTSW 12 103,542,539 (GRCm39) critical splice acceptor site probably null
R2404:Ppp4r4 UTSW 12 103,547,749 (GRCm39) splice site probably null
R2696:Ppp4r4 UTSW 12 103,547,653 (GRCm39) missense possibly damaging 0.77
R2849:Ppp4r4 UTSW 12 103,573,192 (GRCm39) missense probably benign 0.00
R2965:Ppp4r4 UTSW 12 103,579,080 (GRCm39) missense probably damaging 1.00
R3030:Ppp4r4 UTSW 12 103,573,215 (GRCm39) missense probably benign
R3805:Ppp4r4 UTSW 12 103,566,625 (GRCm39) missense probably damaging 0.99
R3862:Ppp4r4 UTSW 12 103,562,680 (GRCm39) nonsense probably null
R4194:Ppp4r4 UTSW 12 103,524,704 (GRCm39) missense probably damaging 1.00
R4320:Ppp4r4 UTSW 12 103,564,502 (GRCm39) missense probably damaging 1.00
R4558:Ppp4r4 UTSW 12 103,573,192 (GRCm39) missense probably benign 0.00
R4783:Ppp4r4 UTSW 12 103,557,117 (GRCm39) critical splice donor site probably null
R4866:Ppp4r4 UTSW 12 103,566,706 (GRCm39) missense possibly damaging 0.92
R4903:Ppp4r4 UTSW 12 103,557,030 (GRCm39) splice site probably null
R5309:Ppp4r4 UTSW 12 103,573,147 (GRCm39) splice site probably null
R5312:Ppp4r4 UTSW 12 103,573,147 (GRCm39) splice site probably null
R5381:Ppp4r4 UTSW 12 103,559,357 (GRCm39) missense probably benign 0.00
R5383:Ppp4r4 UTSW 12 103,550,427 (GRCm39) missense probably benign 0.14
R5447:Ppp4r4 UTSW 12 103,550,410 (GRCm39) missense possibly damaging 0.67
R5942:Ppp4r4 UTSW 12 103,553,706 (GRCm39) missense possibly damaging 0.92
R6339:Ppp4r4 UTSW 12 103,571,228 (GRCm39) nonsense probably null
R6386:Ppp4r4 UTSW 12 103,559,364 (GRCm39) missense probably damaging 1.00
R6712:Ppp4r4 UTSW 12 103,562,702 (GRCm39) missense probably damaging 1.00
R6755:Ppp4r4 UTSW 12 103,551,996 (GRCm39) missense probably damaging 1.00
R6868:Ppp4r4 UTSW 12 103,557,111 (GRCm39) missense probably damaging 1.00
R6879:Ppp4r4 UTSW 12 103,518,179 (GRCm39) splice site probably null
R7355:Ppp4r4 UTSW 12 103,570,841 (GRCm39) nonsense probably null
R7397:Ppp4r4 UTSW 12 103,579,065 (GRCm39) critical splice acceptor site probably null
R7447:Ppp4r4 UTSW 12 103,551,985 (GRCm39) missense possibly damaging 0.46
R7576:Ppp4r4 UTSW 12 103,562,708 (GRCm39) missense probably damaging 0.97
R7653:Ppp4r4 UTSW 12 103,550,404 (GRCm39) missense probably damaging 0.98
R7683:Ppp4r4 UTSW 12 103,553,364 (GRCm39) nonsense probably null
R7831:Ppp4r4 UTSW 12 103,557,080 (GRCm39) missense possibly damaging 0.76
R7833:Ppp4r4 UTSW 12 103,564,407 (GRCm39) missense probably benign 0.03
R8238:Ppp4r4 UTSW 12 103,557,066 (GRCm39) missense probably benign 0.20
R8559:Ppp4r4 UTSW 12 103,559,420 (GRCm39) missense probably benign 0.04
R8674:Ppp4r4 UTSW 12 103,562,720 (GRCm39) missense probably damaging 0.97
R8799:Ppp4r4 UTSW 12 103,567,623 (GRCm39) missense possibly damaging 0.60
R8847:Ppp4r4 UTSW 12 103,562,747 (GRCm39) missense probably damaging 1.00
R8968:Ppp4r4 UTSW 12 103,566,706 (GRCm39) missense probably benign 0.00
R9075:Ppp4r4 UTSW 12 103,570,290 (GRCm39) nonsense probably null
R9106:Ppp4r4 UTSW 12 103,570,315 (GRCm39) missense probably benign 0.01
R9393:Ppp4r4 UTSW 12 103,571,296 (GRCm39) nonsense probably null
R9508:Ppp4r4 UTSW 12 103,542,561 (GRCm39) missense possibly damaging 0.65
R9520:Ppp4r4 UTSW 12 103,500,378 (GRCm39) missense probably benign 0.00
R9636:Ppp4r4 UTSW 12 103,564,688 (GRCm39) missense unknown
R9641:Ppp4r4 UTSW 12 103,567,811 (GRCm39) missense probably benign 0.15
R9765:Ppp4r4 UTSW 12 103,550,346 (GRCm39) nonsense probably null
R9766:Ppp4r4 UTSW 12 103,562,735 (GRCm39) missense probably benign 0.40
X0025:Ppp4r4 UTSW 12 103,566,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGATGTGTCCCGAGGAGG -3'
(R):5'- GAGGTATGGACAGCATAGTCTG -3'

Sequencing Primer
(F):5'- CCGAGGAGGGCTTTGGG -3'
(R):5'- GCATAGTCTGCCTTTCTCATAAATG -3'
Posted On 2019-11-26