Incidental Mutation 'R7748:Mtr'
ID 597045
Institutional Source Beutler Lab
Gene Symbol Mtr
Ensembl Gene ENSMUSG00000021311
Gene Name 5-methyltetrahydrofolate-homocysteine methyltransferase
Synonyms methionine synthase, D830038K18Rik, MS
MMRRC Submission 045804-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7748 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 12197598-12272999 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 12242725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 442 (A442T)
Ref Sequence ENSEMBL: ENSMUSP00000097442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099856] [ENSMUST00000221290]
AlphaFold A6H5Y3
Predicted Effect probably benign
Transcript: ENSMUST00000099856
AA Change: A442T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097442
Gene: ENSMUSG00000021311
AA Change: A442T

DomainStartEndE-ValueType
Pfam:S-methyl_trans 18 326 1.5e-93 PFAM
Pfam:Pterin_bind 363 601 4.6e-63 PFAM
B12-binding_2 657 743 6.42e-41 SMART
Pfam:B12-binding 761 861 3.3e-20 PFAM
Pfam:Met_synt_B12 953 1234 2.5e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221290
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 5-methyltetrahydrofolate-homocysteine methyltransferase. This enzyme, also known as cobalamin-dependent methionine synthase, catalyzes the final step in methionine biosynthesis. Mutations in MTR have been identified as the underlying cause of methylcobalamin deficiency complementation group G. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit embryonic lethality prior to E9.5. Heterozygous appear mostly similar to conrtols, except that they exhibit elevated plasma methionine and homocysteine levels. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 130,963,521 (GRCm39) L103F probably benign Het
5330417H12Rik A G 7: 107,223,765 (GRCm39) L103P unknown Het
Actb T C 5: 142,890,450 (GRCm39) I151V probably benign Het
Adcy6 T A 15: 98,502,437 (GRCm39) H59L probably benign Het
Adss2 G C 1: 177,599,768 (GRCm39) S272* probably null Het
Aga A T 8: 53,964,840 (GRCm39) M1L possibly damaging Het
Ajm1 T A 2: 25,468,971 (GRCm39) E313D possibly damaging Het
Anxa5 G A 3: 36,519,480 (GRCm39) T3M probably damaging Het
Arhgap45 A T 10: 79,852,766 (GRCm39) probably benign Het
Atp6v0a2 A T 5: 124,793,560 (GRCm39) H639L probably benign Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bltp1 A G 3: 37,013,484 (GRCm39) probably null Het
Bod1l A C 5: 41,989,683 (GRCm39) S347A probably damaging Het
Calcoco1 T C 15: 102,627,996 (GRCm39) D46G probably damaging Het
Camk1 T C 6: 113,317,289 (GRCm39) E60G probably damaging Het
Capza1 A T 3: 104,732,721 (GRCm39) probably null Het
Ccdc18 T A 5: 108,296,907 (GRCm39) probably null Het
Cdh20 G A 1: 104,869,024 (GRCm39) A172T probably damaging Het
Cdk4 C T 10: 126,900,298 (GRCm39) A65V possibly damaging Het
Cftr T C 6: 18,277,888 (GRCm39) probably null Het
Chd3 T C 11: 69,246,459 (GRCm39) M1092V probably benign Het
Chd6 A T 2: 160,808,539 (GRCm39) H1558Q probably benign Het
Chi3l1 A G 1: 134,116,966 (GRCm39) H318R probably benign Het
Cps1 A G 1: 67,178,965 (GRCm39) Y59C probably damaging Het
Cyb5r4 T C 9: 86,914,434 (GRCm39) V111A probably damaging Het
Ddx39b G A 17: 35,471,726 (GRCm39) V291M probably damaging Het
Dhx57 A G 17: 80,572,546 (GRCm39) F709S probably damaging Het
Eef1b2 A T 1: 63,217,024 (GRCm39) K64N probably damaging Het
Eef1ece2 A T 16: 20,451,834 (GRCm39) D407V probably damaging Het
Fam135a A G 1: 24,068,050 (GRCm39) S940P probably benign Het
Fam234b T A 6: 135,186,349 (GRCm39) V119E probably damaging Het
Fbxo46 G C 7: 18,870,458 (GRCm39) C359S probably damaging Het
Fkbp14 C A 6: 54,572,505 (GRCm39) probably benign Het
Fmn2 T A 1: 174,494,215 (GRCm39) V1243E probably damaging Het
Fsbp C A 4: 11,579,924 (GRCm39) T64K probably damaging Het
Fscb A T 12: 64,521,181 (GRCm39) M95K probably benign Het
Fyb1 T G 15: 6,668,307 (GRCm39) V500G probably damaging Het
G2e3 A G 12: 51,418,450 (GRCm39) N615S probably benign Het
Gart T C 16: 91,427,540 (GRCm39) D486G possibly damaging Het
Gas2l2 T A 11: 83,313,224 (GRCm39) D696V probably benign Het
Glmn C T 5: 107,710,110 (GRCm39) probably null Het
Gm47985 A T 1: 151,058,725 (GRCm39) D122V probably damaging Het
Gm7168 A G 17: 14,168,914 (GRCm39) K94E probably benign Het
Gnai2 T C 9: 107,492,934 (GRCm39) H323R Het
Helz2 C T 2: 180,876,324 (GRCm39) R1390H probably damaging Het
Igf2bp1 T C 11: 95,858,413 (GRCm39) M453V probably benign Het
Ighv3-1 C T 12: 113,928,270 (GRCm39) V30M probably damaging Het
Inpp5a A T 7: 139,154,911 (GRCm39) R343S probably damaging Het
Itga8 T A 2: 12,235,050 (GRCm39) I403F possibly damaging Het
Katnip A T 7: 125,428,973 (GRCm39) M558L probably benign Het
Krt33a C T 11: 99,902,428 (GRCm39) R404H probably benign Het
Krt34 T A 11: 99,929,764 (GRCm39) E244V probably damaging Het
Krt42 T C 11: 100,157,792 (GRCm39) E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 141,728,845 (GRCm39) probably benign Het
Lama1 T C 17: 68,057,585 (GRCm39) L553P Het
Lcn9 T A 2: 25,714,926 (GRCm39) *179K probably null Het
Ldaf1 A T 7: 119,714,702 (GRCm39) I64F possibly damaging Het
Lrrc2 T G 9: 110,809,999 (GRCm39) M345R possibly damaging Het
Marchf11 T C 15: 26,387,916 (GRCm39) V257A probably damaging Het
Masp2 T C 4: 148,690,163 (GRCm39) I224T probably benign Het
Mpz A T 1: 170,987,509 (GRCm39) probably null Het
Muc5b A G 7: 141,401,542 (GRCm39) K596R unknown Het
Myo15a T G 11: 60,395,727 (GRCm39) F1397C Het
Ncor2 T C 5: 125,187,031 (GRCm39) I173V unknown Het
Ngly1 T A 14: 16,290,820 (GRCm38) I434K possibly damaging Het
Notch2 A G 3: 98,045,800 (GRCm39) H1655R possibly damaging Het
Notum C T 11: 120,545,627 (GRCm39) A390T probably damaging Het
Or10a3n T C 7: 108,493,285 (GRCm39) T115A probably benign Het
Or1e22 T G 11: 73,376,994 (GRCm39) I219L probably benign Het
Pds5a T A 5: 65,777,009 (GRCm39) I51F possibly damaging Het
Pdzd2 C A 15: 12,385,872 (GRCm39) R966L possibly damaging Het
Plk3 T C 4: 116,988,925 (GRCm39) Y278C probably damaging Het
Plxna1 C G 6: 89,314,334 (GRCm39) probably null Het
Plxna1 T A 6: 89,314,335 (GRCm39) probably null Het
Ppp4r4 G A 12: 103,571,320 (GRCm39) probably null Het
Pramel6 T A 2: 87,339,043 (GRCm39) V81E probably damaging Het
Prdm2 T C 4: 142,862,459 (GRCm39) E277G possibly damaging Het
Prkg1 T A 19: 30,970,491 (GRCm39) I222F possibly damaging Het
Proser3 A T 7: 30,239,497 (GRCm39) S536T possibly damaging Het
Prrt4 C A 6: 29,177,190 (GRCm39) G193V probably damaging Het
Ptpn21 A T 12: 98,655,031 (GRCm39) H645Q probably benign Het
Ptprd T C 4: 76,017,741 (GRCm39) I744V probably null Het
Rad54l2 A G 9: 106,596,233 (GRCm39) V235A possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rgs22 C T 15: 36,122,415 (GRCm39) probably null Het
Rtcb A T 10: 85,777,832 (GRCm39) D447E probably benign Het
Rtn1 C T 12: 72,263,700 (GRCm39) V744I possibly damaging Het
Scfd1 T G 12: 51,436,140 (GRCm39) I96M probably benign Het
Serpina3b T C 12: 104,096,722 (GRCm39) M1T probably null Het
Slc1a4 T C 11: 20,282,252 (GRCm39) Y74C probably damaging Het
Slc9b2 A T 3: 135,031,940 (GRCm39) I267F possibly damaging Het
Sorcs2 A T 5: 36,386,519 (GRCm39) M173K possibly damaging Het
Sparc T C 11: 55,289,426 (GRCm39) I226V probably benign Het
Spata22 T G 11: 73,227,080 (GRCm39) I98S probably null Het
Spef2 C T 15: 9,653,031 (GRCm39) V917M probably damaging Het
Sspo C A 6: 48,426,399 (GRCm39) C139* probably null Het
Tenm4 A G 7: 96,543,909 (GRCm39) D2012G probably damaging Het
Tgm5 G A 2: 120,883,289 (GRCm39) R351C probably damaging Het
Tmem145 G A 7: 25,006,753 (GRCm39) W82* probably null Het
Topors T A 4: 40,262,654 (GRCm39) D210V probably damaging Het
Tssk4 A T 14: 55,888,569 (GRCm39) H146L probably damaging Het
Unc93b1 T A 19: 3,985,250 (GRCm39) D19E unknown Het
Usp17lc A G 7: 103,067,688 (GRCm39) T328A probably damaging Het
Utrn A G 10: 12,490,252 (GRCm39) Y43H probably benign Het
Vmn1r25 T A 6: 57,955,549 (GRCm39) I247F probably damaging Het
Vmn2r78 A T 7: 86,570,343 (GRCm39) Q287L probably benign Het
Vps13c T A 9: 67,870,371 (GRCm39) I3170N probably benign Het
Zfc3h1 T A 10: 115,236,720 (GRCm39) M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp773 T C 7: 7,135,907 (GRCm39) R230G probably benign Het
Other mutations in Mtr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Mtr APN 13 12,240,536 (GRCm39) splice site probably benign
IGL02456:Mtr APN 13 12,213,980 (GRCm39) missense probably damaging 0.98
IGL02573:Mtr APN 13 12,214,013 (GRCm39) missense possibly damaging 0.95
IGL02642:Mtr APN 13 12,210,118 (GRCm39) splice site probably benign
IGL03005:Mtr APN 13 12,250,335 (GRCm39) splice site probably benign
IGL03017:Mtr APN 13 12,262,777 (GRCm39) critical splice donor site probably null
IGL03036:Mtr APN 13 12,262,263 (GRCm39) missense probably damaging 1.00
H8930:Mtr UTSW 13 12,250,346 (GRCm39) missense probably damaging 1.00
PIT4431001:Mtr UTSW 13 12,227,329 (GRCm39) missense probably damaging 1.00
PIT4520001:Mtr UTSW 13 12,212,871 (GRCm39) nonsense probably null
R0011:Mtr UTSW 13 12,252,938 (GRCm39) splice site probably benign
R0047:Mtr UTSW 13 12,237,112 (GRCm39) missense probably damaging 1.00
R0047:Mtr UTSW 13 12,237,112 (GRCm39) missense probably damaging 1.00
R0304:Mtr UTSW 13 12,237,040 (GRCm39) critical splice donor site probably null
R0617:Mtr UTSW 13 12,236,318 (GRCm39) missense probably benign
R0842:Mtr UTSW 13 12,215,133 (GRCm39) missense probably damaging 1.00
R1101:Mtr UTSW 13 12,204,411 (GRCm39) missense possibly damaging 0.84
R1450:Mtr UTSW 13 12,208,619 (GRCm39) missense probably damaging 0.99
R1534:Mtr UTSW 13 12,250,430 (GRCm39) splice site probably benign
R1907:Mtr UTSW 13 12,240,418 (GRCm39) missense probably damaging 1.00
R2111:Mtr UTSW 13 12,259,487 (GRCm39) missense possibly damaging 0.86
R2354:Mtr UTSW 13 12,203,043 (GRCm39) splice site probably benign
R3849:Mtr UTSW 13 12,262,251 (GRCm39) missense probably benign 0.16
R3899:Mtr UTSW 13 12,231,735 (GRCm39) missense probably benign 0.00
R4012:Mtr UTSW 13 12,204,284 (GRCm39) missense probably damaging 1.00
R4012:Mtr UTSW 13 12,204,283 (GRCm39) missense probably damaging 1.00
R4075:Mtr UTSW 13 12,230,298 (GRCm39) critical splice donor site probably null
R4091:Mtr UTSW 13 12,245,943 (GRCm39) missense probably damaging 1.00
R4655:Mtr UTSW 13 12,242,679 (GRCm39) missense probably damaging 1.00
R4801:Mtr UTSW 13 12,210,137 (GRCm39) missense probably benign 0.01
R4802:Mtr UTSW 13 12,210,137 (GRCm39) missense probably benign 0.01
R4895:Mtr UTSW 13 12,231,752 (GRCm39) missense probably benign 0.01
R5481:Mtr UTSW 13 12,203,041 (GRCm39) critical splice acceptor site probably null
R5966:Mtr UTSW 13 12,230,453 (GRCm39) critical splice acceptor site probably null
R6209:Mtr UTSW 13 12,205,278 (GRCm39) missense probably benign 0.00
R6348:Mtr UTSW 13 12,262,840 (GRCm39) missense possibly damaging 0.49
R6463:Mtr UTSW 13 12,231,752 (GRCm39) missense probably benign 0.01
R6467:Mtr UTSW 13 12,202,992 (GRCm39) missense probably damaging 1.00
R7046:Mtr UTSW 13 12,205,095 (GRCm39) missense possibly damaging 0.58
R7505:Mtr UTSW 13 12,236,362 (GRCm39) missense probably benign 0.02
R7575:Mtr UTSW 13 12,213,963 (GRCm39) missense probably benign 0.01
R7705:Mtr UTSW 13 12,264,782 (GRCm39) missense probably benign
R8161:Mtr UTSW 13 12,236,372 (GRCm39) missense probably damaging 0.99
R8290:Mtr UTSW 13 12,205,139 (GRCm39) missense probably damaging 1.00
R8988:Mtr UTSW 13 12,250,365 (GRCm39) missense probably benign
R9050:Mtr UTSW 13 12,231,748 (GRCm39) missense probably null 0.67
R9420:Mtr UTSW 13 12,268,764 (GRCm39) missense probably benign 0.04
R9655:Mtr UTSW 13 12,203,030 (GRCm39) missense probably damaging 1.00
X0064:Mtr UTSW 13 12,265,543 (GRCm39) missense probably damaging 1.00
Z1177:Mtr UTSW 13 12,264,752 (GRCm39) nonsense probably null
Z1177:Mtr UTSW 13 12,201,935 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AGCAGAAGCCACTTACTTGTC -3'
(R):5'- CCATGTGCATAGTCTCCTGTG -3'

Sequencing Primer
(F):5'- AGAAGCCACTTACTTGTCCTTCC -3'
(R):5'- GCATAGTCTCCTGTGAGCTGATC -3'
Posted On 2019-11-26