Incidental Mutation 'R0632:Vsig10l'
ID 59705
Institutional Source Beutler Lab
Gene Symbol Vsig10l
Ensembl Gene ENSMUSG00000070604
Gene Name V-set and immunoglobulin domain containing 10 like
Synonyms
MMRRC Submission 038821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock # R0632 (G1)
Quality Score 215
Status Validated
Chromosome 7
Chromosomal Location 43463151-43472019 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 43464137 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 171 (V171G)
Ref Sequence ENSEMBL: ENSMUSP00000144692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107977] [ENSMUST00000203042] [ENSMUST00000203633] [ENSMUST00000203769] [ENSMUST00000204680]
AlphaFold D3YZF7
Predicted Effect possibly damaging
Transcript: ENSMUST00000107977
AA Change: V273G

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103611
Gene: ENSMUSG00000070604
AA Change: V273G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
IG 183 285 1.92e0 SMART
IG 298 383 2.15e-3 SMART
IGc2 406 465 4.19e-6 SMART
Blast:IG_like 582 649 1e-13 BLAST
transmembrane domain 764 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203152
Predicted Effect probably benign
Transcript: ENSMUST00000203633
SMART Domains Protein: ENSMUSP00000145061
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 216 2.7e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203769
AA Change: V171G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144692
Gene: ENSMUSG00000070604
AA Change: V171G

DomainStartEndE-ValueType
IG 81 183 8.1e-3 SMART
IG 196 281 9.2e-6 SMART
IGc2 304 363 1.8e-8 SMART
Blast:IG_like 480 547 9e-14 BLAST
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204680
SMART Domains Protein: ENSMUSP00000145493
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 168 2.4e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205247
Meta Mutation Damage Score 0.1002 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,227,618 D83G probably benign Het
Acaa1a T A 9: 119,347,818 probably benign Het
Adgrg7 T A 16: 56,742,589 T462S possibly damaging Het
Akap6 A T 12: 52,937,148 N825I probably damaging Het
Ankib1 T A 5: 3,772,529 N59I probably benign Het
Anks6 T C 4: 47,033,167 S633G possibly damaging Het
Ap4e1 C A 2: 127,049,280 Y522* probably null Het
Art5 G A 7: 102,097,957 T205I probably damaging Het
Ascc2 T A 11: 4,649,855 L176H probably damaging Het
Atp13a5 T C 16: 29,298,208 D529G probably benign Het
C2cd4a T C 9: 67,831,563 E66G probably benign Het
C8a T C 4: 104,856,492 D147G probably damaging Het
Ccdc109b T C 3: 129,918,726 M167V probably benign Het
Ccdc14 T C 16: 34,721,649 V532A possibly damaging Het
Ccdc88a T A 11: 29,482,749 probably benign Het
Cfap54 C T 10: 92,885,096 E2543K unknown Het
Cldn13 C T 5: 134,914,747 E195K probably benign Het
Cp A G 3: 19,971,082 S402G probably null Het
Cpa3 T C 3: 20,225,194 T194A probably benign Het
Crygf C A 1: 65,927,997 Y93* probably null Het
Ctsh A G 9: 90,061,582 R87G possibly damaging Het
Cyp2t4 A G 7: 27,158,246 D428G possibly damaging Het
Dnah17 C G 11: 118,067,682 probably benign Het
Dnah3 A G 7: 119,967,905 V2366A probably benign Het
Dscaml1 A T 9: 45,732,134 I1284F probably benign Het
Dsg1c T C 18: 20,272,346 probably benign Het
Dst G T 1: 34,271,413 R4098L probably damaging Het
Efhb A G 17: 53,413,459 probably benign Het
Epha7 A T 4: 28,821,104 I90F probably damaging Het
Fam171a2 T A 11: 102,437,881 D684V probably damaging Het
Fan1 A G 7: 64,363,199 V665A possibly damaging Het
Fbn2 A G 18: 58,037,747 C2191R probably damaging Het
Fkbp3 G A 12: 65,073,918 A2V probably benign Het
G6pd2 A G 5: 61,810,171 N430D probably benign Het
Gm13119 G A 4: 144,363,782 C464Y probably damaging Het
Gm13547 T A 2: 29,761,584 D7E possibly damaging Het
Hdac5 A T 11: 102,205,812 D260E probably damaging Het
Hist1h4i G T 13: 22,041,027 Y99* probably null Het
Hsf2bp T C 17: 32,013,346 E142G probably damaging Het
Igf1r C T 7: 68,165,155 T268I probably damaging Het
Kcne3 C T 7: 100,184,439 R88C probably damaging Het
Klk1b9 G T 7: 43,979,372 G100V possibly damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lama1 C T 17: 67,752,368 probably benign Het
Lcp2 C T 11: 34,082,426 P335S possibly damaging Het
Lrrk2 T A 15: 91,796,028 N2047K probably damaging Het
Mia2 T C 12: 59,136,143 L36P probably damaging Het
Mmp13 A T 9: 7,282,077 I460F possibly damaging Het
Mmp13 G A 9: 7,274,032 G169R probably damaging Het
Msh4 A G 3: 153,896,895 I232T probably damaging Het
Msra T A 14: 64,210,532 M145L probably benign Het
Myo7a A T 7: 98,112,150 probably benign Het
Nme8 A T 13: 19,658,036 N422K probably damaging Het
Nol6 A T 4: 41,121,115 F353I probably damaging Het
Nphp3 A G 9: 104,018,274 K384E probably damaging Het
Olfr572 C T 7: 102,928,604 probably null Het
Olfr652 A G 7: 104,564,337 I39V probably benign Het
Olfr672 A G 7: 104,996,703 I67T probably benign Het
Phox2b T G 5: 67,096,214 probably benign Het
Plec A T 15: 76,173,411 S4131T probably damaging Het
Pptc7 G A 5: 122,313,591 probably benign Het
Prpf40b A G 15: 99,316,289 E810G probably benign Het
Ptprc C T 1: 138,073,610 V965I probably benign Het
Pum1 T A 4: 130,728,104 M180K probably benign Het
Ranbp3 T C 17: 56,702,896 probably benign Het
Rasgrf2 A G 13: 91,972,274 S787P probably benign Het
Rnf19b T A 4: 129,073,551 N294K probably damaging Het
Samd3 A T 10: 26,244,495 H156L possibly damaging Het
Serpinb6c C T 13: 33,880,031 R347Q possibly damaging Het
Slc36a3 A G 11: 55,125,080 I416T probably damaging Het
Slc4a4 T A 5: 89,129,641 F279Y probably damaging Het
Slc6a2 T A 8: 92,992,801 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tab2 A G 10: 7,919,801 S232P probably benign Het
Tacc2 A T 7: 130,625,595 K1356* probably null Het
Tmem87a A G 2: 120,359,542 S544P probably damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Usp38 A T 8: 81,014,150 V96E probably benign Het
Vmn2r59 T C 7: 42,058,884 Y33C probably damaging Het
Zfp957 T A 14: 79,212,920 I480F probably damaging Het
Other mutations in Vsig10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Vsig10l APN 7 43465254 missense probably damaging 1.00
IGL01390:Vsig10l APN 7 43466465 missense probably damaging 0.97
IGL02401:Vsig10l APN 7 43464044 missense probably damaging 1.00
IGL02404:Vsig10l APN 7 43463747 missense possibly damaging 0.85
IGL02514:Vsig10l APN 7 43463914 missense probably benign 0.02
IGL02636:Vsig10l APN 7 43463578 missense possibly damaging 0.53
IGL02805:Vsig10l APN 7 43465242 missense probably damaging 1.00
IGL02823:Vsig10l APN 7 43466464 missense probably damaging 1.00
IGL02827:Vsig10l APN 7 43464869 missense probably damaging 1.00
R0111:Vsig10l UTSW 7 43468101 missense probably damaging 0.97
R0394:Vsig10l UTSW 7 43465455 missense probably damaging 0.97
R0465:Vsig10l UTSW 7 43467442 missense probably damaging 1.00
R1689:Vsig10l UTSW 7 43465368 missense possibly damaging 0.93
R1991:Vsig10l UTSW 7 43467468 missense possibly damaging 0.89
R2103:Vsig10l UTSW 7 43467468 missense possibly damaging 0.89
R2358:Vsig10l UTSW 7 43468761 missense probably benign 0.00
R3015:Vsig10l UTSW 7 43467457 missense possibly damaging 0.73
R4024:Vsig10l UTSW 7 43468086 missense probably benign 0.33
R4031:Vsig10l UTSW 7 43465374 missense probably damaging 1.00
R4807:Vsig10l UTSW 7 43463749 missense possibly damaging 0.53
R5020:Vsig10l UTSW 7 43465317 nonsense probably null
R5261:Vsig10l UTSW 7 43470850 missense probably damaging 1.00
R5317:Vsig10l UTSW 7 43464823 missense probably damaging 1.00
R5426:Vsig10l UTSW 7 43464823 missense probably damaging 0.97
R5656:Vsig10l UTSW 7 43464151 nonsense probably null
R5842:Vsig10l UTSW 7 43468972 missense probably benign 0.15
R6012:Vsig10l UTSW 7 43468015 missense probably damaging 1.00
R6235:Vsig10l UTSW 7 43468972 missense probably benign 0.15
R6309:Vsig10l UTSW 7 43470973 splice site probably null
R6994:Vsig10l UTSW 7 43465067 missense possibly damaging 0.71
R7250:Vsig10l UTSW 7 43463675 missense probably benign
R7397:Vsig10l UTSW 7 43468007 missense probably damaging 1.00
R7767:Vsig10l UTSW 7 43463717 missense probably damaging 0.96
R7956:Vsig10l UTSW 7 43468070 missense probably benign
R8086:Vsig10l UTSW 7 43465452 missense possibly damaging 0.92
R8139:Vsig10l UTSW 7 43463729 missense probably benign 0.00
R8297:Vsig10l UTSW 7 43464107 missense possibly damaging 0.50
R8341:Vsig10l UTSW 7 43463954 missense probably damaging 1.00
R8519:Vsig10l UTSW 7 43464902 missense probably benign 0.33
R8925:Vsig10l UTSW 7 43466596 missense probably benign 0.41
R8927:Vsig10l UTSW 7 43466596 missense probably benign 0.41
R8948:Vsig10l UTSW 7 43468199 missense possibly damaging 0.53
R9157:Vsig10l UTSW 7 43463524 missense
R9203:Vsig10l UTSW 7 43463233 start codon destroyed probably null
X0028:Vsig10l UTSW 7 43463364 utr 3 prime probably benign
X0067:Vsig10l UTSW 7 43467490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCAAGCTTTCCTCAGCAAGTG -3'
(R):5'- AGACCTCCTCCTTCAGACAAGGTG -3'

Sequencing Primer
(F):5'- TGCTAGTGGGAACCACCATC -3'
(R):5'- GCTCTGGTCCCTGCCTTTG -3'
Posted On 2013-07-11