Incidental Mutation 'R7748:Rgs22'
ID 597054
Institutional Source Beutler Lab
Gene Symbol Rgs22
Ensembl Gene ENSMUSG00000037627
Gene Name regulator of G-protein signalling 22
Synonyms
MMRRC Submission 045804-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7748 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 36009625-36140546 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 36122415 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172831]
AlphaFold G3UYX5
Predicted Effect probably null
Transcript: ENSMUST00000172831
SMART Domains Protein: ENSMUSP00000134259
Gene: ENSMUSG00000037627

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 173 179 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
RGS 845 973 3.15e-2 SMART
RGS 1014 1134 1.56e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 130,963,521 (GRCm39) L103F probably benign Het
5330417H12Rik A G 7: 107,223,765 (GRCm39) L103P unknown Het
Actb T C 5: 142,890,450 (GRCm39) I151V probably benign Het
Adcy6 T A 15: 98,502,437 (GRCm39) H59L probably benign Het
Adss2 G C 1: 177,599,768 (GRCm39) S272* probably null Het
Aga A T 8: 53,964,840 (GRCm39) M1L possibly damaging Het
Ajm1 T A 2: 25,468,971 (GRCm39) E313D possibly damaging Het
Anxa5 G A 3: 36,519,480 (GRCm39) T3M probably damaging Het
Arhgap45 A T 10: 79,852,766 (GRCm39) probably benign Het
Atp6v0a2 A T 5: 124,793,560 (GRCm39) H639L probably benign Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bltp1 A G 3: 37,013,484 (GRCm39) probably null Het
Bod1l A C 5: 41,989,683 (GRCm39) S347A probably damaging Het
Calcoco1 T C 15: 102,627,996 (GRCm39) D46G probably damaging Het
Camk1 T C 6: 113,317,289 (GRCm39) E60G probably damaging Het
Capza1 A T 3: 104,732,721 (GRCm39) probably null Het
Ccdc18 T A 5: 108,296,907 (GRCm39) probably null Het
Cdh20 G A 1: 104,869,024 (GRCm39) A172T probably damaging Het
Cdk4 C T 10: 126,900,298 (GRCm39) A65V possibly damaging Het
Cftr T C 6: 18,277,888 (GRCm39) probably null Het
Chd3 T C 11: 69,246,459 (GRCm39) M1092V probably benign Het
Chd6 A T 2: 160,808,539 (GRCm39) H1558Q probably benign Het
Chi3l1 A G 1: 134,116,966 (GRCm39) H318R probably benign Het
Cps1 A G 1: 67,178,965 (GRCm39) Y59C probably damaging Het
Cyb5r4 T C 9: 86,914,434 (GRCm39) V111A probably damaging Het
Ddx39b G A 17: 35,471,726 (GRCm39) V291M probably damaging Het
Dhx57 A G 17: 80,572,546 (GRCm39) F709S probably damaging Het
Eef1b2 A T 1: 63,217,024 (GRCm39) K64N probably damaging Het
Eef1ece2 A T 16: 20,451,834 (GRCm39) D407V probably damaging Het
Fam135a A G 1: 24,068,050 (GRCm39) S940P probably benign Het
Fam234b T A 6: 135,186,349 (GRCm39) V119E probably damaging Het
Fbxo46 G C 7: 18,870,458 (GRCm39) C359S probably damaging Het
Fkbp14 C A 6: 54,572,505 (GRCm39) probably benign Het
Fmn2 T A 1: 174,494,215 (GRCm39) V1243E probably damaging Het
Fsbp C A 4: 11,579,924 (GRCm39) T64K probably damaging Het
Fscb A T 12: 64,521,181 (GRCm39) M95K probably benign Het
Fyb1 T G 15: 6,668,307 (GRCm39) V500G probably damaging Het
G2e3 A G 12: 51,418,450 (GRCm39) N615S probably benign Het
Gart T C 16: 91,427,540 (GRCm39) D486G possibly damaging Het
Gas2l2 T A 11: 83,313,224 (GRCm39) D696V probably benign Het
Glmn C T 5: 107,710,110 (GRCm39) probably null Het
Gm47985 A T 1: 151,058,725 (GRCm39) D122V probably damaging Het
Gm7168 A G 17: 14,168,914 (GRCm39) K94E probably benign Het
Gnai2 T C 9: 107,492,934 (GRCm39) H323R Het
Helz2 C T 2: 180,876,324 (GRCm39) R1390H probably damaging Het
Igf2bp1 T C 11: 95,858,413 (GRCm39) M453V probably benign Het
Ighv3-1 C T 12: 113,928,270 (GRCm39) V30M probably damaging Het
Inpp5a A T 7: 139,154,911 (GRCm39) R343S probably damaging Het
Itga8 T A 2: 12,235,050 (GRCm39) I403F possibly damaging Het
Katnip A T 7: 125,428,973 (GRCm39) M558L probably benign Het
Krt33a C T 11: 99,902,428 (GRCm39) R404H probably benign Het
Krt34 T A 11: 99,929,764 (GRCm39) E244V probably damaging Het
Krt42 T C 11: 100,157,792 (GRCm39) E224G probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 141,728,845 (GRCm39) probably benign Het
Lama1 T C 17: 68,057,585 (GRCm39) L553P Het
Lcn9 T A 2: 25,714,926 (GRCm39) *179K probably null Het
Ldaf1 A T 7: 119,714,702 (GRCm39) I64F possibly damaging Het
Lrrc2 T G 9: 110,809,999 (GRCm39) M345R possibly damaging Het
Marchf11 T C 15: 26,387,916 (GRCm39) V257A probably damaging Het
Masp2 T C 4: 148,690,163 (GRCm39) I224T probably benign Het
Mpz A T 1: 170,987,509 (GRCm39) probably null Het
Mtr C T 13: 12,242,725 (GRCm39) A442T probably benign Het
Muc5b A G 7: 141,401,542 (GRCm39) K596R unknown Het
Myo15a T G 11: 60,395,727 (GRCm39) F1397C Het
Ncor2 T C 5: 125,187,031 (GRCm39) I173V unknown Het
Ngly1 T A 14: 16,290,820 (GRCm38) I434K possibly damaging Het
Notch2 A G 3: 98,045,800 (GRCm39) H1655R possibly damaging Het
Notum C T 11: 120,545,627 (GRCm39) A390T probably damaging Het
Or10a3n T C 7: 108,493,285 (GRCm39) T115A probably benign Het
Or1e22 T G 11: 73,376,994 (GRCm39) I219L probably benign Het
Pds5a T A 5: 65,777,009 (GRCm39) I51F possibly damaging Het
Pdzd2 C A 15: 12,385,872 (GRCm39) R966L possibly damaging Het
Plk3 T C 4: 116,988,925 (GRCm39) Y278C probably damaging Het
Plxna1 C G 6: 89,314,334 (GRCm39) probably null Het
Plxna1 T A 6: 89,314,335 (GRCm39) probably null Het
Ppp4r4 G A 12: 103,571,320 (GRCm39) probably null Het
Pramel6 T A 2: 87,339,043 (GRCm39) V81E probably damaging Het
Prdm2 T C 4: 142,862,459 (GRCm39) E277G possibly damaging Het
Prkg1 T A 19: 30,970,491 (GRCm39) I222F possibly damaging Het
Proser3 A T 7: 30,239,497 (GRCm39) S536T possibly damaging Het
Prrt4 C A 6: 29,177,190 (GRCm39) G193V probably damaging Het
Ptpn21 A T 12: 98,655,031 (GRCm39) H645Q probably benign Het
Ptprd T C 4: 76,017,741 (GRCm39) I744V probably null Het
Rad54l2 A G 9: 106,596,233 (GRCm39) V235A possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rtcb A T 10: 85,777,832 (GRCm39) D447E probably benign Het
Rtn1 C T 12: 72,263,700 (GRCm39) V744I possibly damaging Het
Scfd1 T G 12: 51,436,140 (GRCm39) I96M probably benign Het
Serpina3b T C 12: 104,096,722 (GRCm39) M1T probably null Het
Slc1a4 T C 11: 20,282,252 (GRCm39) Y74C probably damaging Het
Slc9b2 A T 3: 135,031,940 (GRCm39) I267F possibly damaging Het
Sorcs2 A T 5: 36,386,519 (GRCm39) M173K possibly damaging Het
Sparc T C 11: 55,289,426 (GRCm39) I226V probably benign Het
Spata22 T G 11: 73,227,080 (GRCm39) I98S probably null Het
Spef2 C T 15: 9,653,031 (GRCm39) V917M probably damaging Het
Sspo C A 6: 48,426,399 (GRCm39) C139* probably null Het
Tenm4 A G 7: 96,543,909 (GRCm39) D2012G probably damaging Het
Tgm5 G A 2: 120,883,289 (GRCm39) R351C probably damaging Het
Tmem145 G A 7: 25,006,753 (GRCm39) W82* probably null Het
Topors T A 4: 40,262,654 (GRCm39) D210V probably damaging Het
Tssk4 A T 14: 55,888,569 (GRCm39) H146L probably damaging Het
Unc93b1 T A 19: 3,985,250 (GRCm39) D19E unknown Het
Usp17lc A G 7: 103,067,688 (GRCm39) T328A probably damaging Het
Utrn A G 10: 12,490,252 (GRCm39) Y43H probably benign Het
Vmn1r25 T A 6: 57,955,549 (GRCm39) I247F probably damaging Het
Vmn2r78 A T 7: 86,570,343 (GRCm39) Q287L probably benign Het
Vps13c T A 9: 67,870,371 (GRCm39) I3170N probably benign Het
Zfc3h1 T A 10: 115,236,720 (GRCm39) M398K probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp773 T C 7: 7,135,907 (GRCm39) R230G probably benign Het
Other mutations in Rgs22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Rgs22 APN 15 36,100,077 (GRCm39) missense possibly damaging 0.93
IGL00594:Rgs22 APN 15 36,083,777 (GRCm39) missense probably benign 0.00
IGL01464:Rgs22 APN 15 36,083,787 (GRCm39) missense possibly damaging 0.90
IGL01686:Rgs22 APN 15 36,103,981 (GRCm39) missense probably benign 0.00
IGL01761:Rgs22 APN 15 36,103,897 (GRCm39) missense probably damaging 0.99
IGL02045:Rgs22 APN 15 36,013,300 (GRCm39) missense probably benign 0.33
IGL02378:Rgs22 APN 15 36,103,951 (GRCm39) missense probably benign 0.00
IGL02490:Rgs22 APN 15 36,054,993 (GRCm39) missense probably damaging 1.00
IGL03219:Rgs22 APN 15 36,107,194 (GRCm39) missense probably damaging 1.00
IGL03229:Rgs22 APN 15 36,015,925 (GRCm39) splice site probably benign
IGL03328:Rgs22 APN 15 36,043,350 (GRCm39) critical splice donor site probably null
3-1:Rgs22 UTSW 15 36,100,182 (GRCm39) missense possibly damaging 0.48
R0254:Rgs22 UTSW 15 36,104,698 (GRCm39) missense probably damaging 0.99
R0463:Rgs22 UTSW 15 36,093,084 (GRCm39) missense probably damaging 1.00
R0467:Rgs22 UTSW 15 36,099,941 (GRCm39) nonsense probably null
R0486:Rgs22 UTSW 15 36,093,028 (GRCm39) missense probably damaging 0.98
R0554:Rgs22 UTSW 15 36,054,855 (GRCm39) missense probably benign 0.10
R0602:Rgs22 UTSW 15 36,140,018 (GRCm39) splice site probably benign
R0906:Rgs22 UTSW 15 36,104,048 (GRCm39) intron probably benign
R1159:Rgs22 UTSW 15 36,040,839 (GRCm39) missense probably damaging 1.00
R1300:Rgs22 UTSW 15 36,101,908 (GRCm39) missense probably benign 0.43
R1439:Rgs22 UTSW 15 36,025,939 (GRCm39) splice site probably benign
R1491:Rgs22 UTSW 15 36,093,047 (GRCm39) missense probably damaging 0.98
R1502:Rgs22 UTSW 15 36,080,997 (GRCm39) missense probably damaging 1.00
R1514:Rgs22 UTSW 15 36,013,246 (GRCm39) missense probably benign 0.00
R1538:Rgs22 UTSW 15 36,048,922 (GRCm39) missense probably damaging 1.00
R1784:Rgs22 UTSW 15 36,087,582 (GRCm39) missense probably damaging 1.00
R1938:Rgs22 UTSW 15 36,101,950 (GRCm39) missense probably benign 0.00
R1972:Rgs22 UTSW 15 36,103,982 (GRCm39) missense probably benign 0.01
R2109:Rgs22 UTSW 15 36,099,880 (GRCm39) nonsense probably null
R2208:Rgs22 UTSW 15 36,050,378 (GRCm39) missense probably benign 0.01
R3696:Rgs22 UTSW 15 36,100,038 (GRCm39) missense probably benign 0.00
R3697:Rgs22 UTSW 15 36,100,038 (GRCm39) missense probably benign 0.00
R3698:Rgs22 UTSW 15 36,100,038 (GRCm39) missense probably benign 0.00
R3879:Rgs22 UTSW 15 36,107,051 (GRCm39) missense possibly damaging 0.52
R4080:Rgs22 UTSW 15 36,107,222 (GRCm39) missense probably damaging 1.00
R4363:Rgs22 UTSW 15 36,104,020 (GRCm39) missense probably damaging 0.99
R4591:Rgs22 UTSW 15 36,100,282 (GRCm39) missense probably benign 0.01
R4673:Rgs22 UTSW 15 36,100,079 (GRCm39) missense probably benign 0.04
R4829:Rgs22 UTSW 15 36,104,034 (GRCm39) missense probably damaging 1.00
R4831:Rgs22 UTSW 15 36,050,294 (GRCm39) missense probably benign 0.00
R4865:Rgs22 UTSW 15 36,100,358 (GRCm39) missense probably damaging 1.00
R4907:Rgs22 UTSW 15 36,087,570 (GRCm39) missense possibly damaging 0.61
R4944:Rgs22 UTSW 15 36,026,088 (GRCm39) missense possibly damaging 0.83
R4975:Rgs22 UTSW 15 36,055,022 (GRCm39) nonsense probably null
R5056:Rgs22 UTSW 15 36,050,391 (GRCm39) splice site probably null
R5126:Rgs22 UTSW 15 36,040,790 (GRCm39) missense probably damaging 0.96
R5138:Rgs22 UTSW 15 36,099,934 (GRCm39) missense probably benign 0.04
R5444:Rgs22 UTSW 15 36,015,773 (GRCm39) missense possibly damaging 0.83
R5507:Rgs22 UTSW 15 36,099,798 (GRCm39) missense probably damaging 0.99
R5640:Rgs22 UTSW 15 36,107,101 (GRCm39) missense probably benign 0.00
R5969:Rgs22 UTSW 15 36,015,782 (GRCm39) missense probably benign 0.00
R6005:Rgs22 UTSW 15 36,010,713 (GRCm39) missense probably benign 0.39
R6053:Rgs22 UTSW 15 36,100,153 (GRCm39) missense probably benign 0.04
R6134:Rgs22 UTSW 15 36,107,194 (GRCm39) missense probably damaging 1.00
R6230:Rgs22 UTSW 15 36,100,176 (GRCm39) missense probably benign 0.02
R6295:Rgs22 UTSW 15 36,087,520 (GRCm39) missense probably benign 0.00
R6352:Rgs22 UTSW 15 36,093,067 (GRCm39) missense probably damaging 1.00
R6809:Rgs22 UTSW 15 36,048,910 (GRCm39) missense probably damaging 1.00
R6900:Rgs22 UTSW 15 36,010,893 (GRCm39) missense possibly damaging 0.61
R6947:Rgs22 UTSW 15 36,104,036 (GRCm39) critical splice acceptor site probably null
R7102:Rgs22 UTSW 15 36,122,459 (GRCm39) missense probably damaging 1.00
R7126:Rgs22 UTSW 15 36,103,954 (GRCm39) missense probably damaging 0.97
R7263:Rgs22 UTSW 15 36,015,789 (GRCm39) missense possibly damaging 0.86
R7623:Rgs22 UTSW 15 36,040,856 (GRCm39) missense probably benign 0.08
R7732:Rgs22 UTSW 15 36,026,127 (GRCm39) missense probably damaging 1.00
R7771:Rgs22 UTSW 15 36,050,224 (GRCm39) missense possibly damaging 0.94
R7835:Rgs22 UTSW 15 36,082,057 (GRCm39) critical splice donor site probably null
R7849:Rgs22 UTSW 15 36,099,858 (GRCm39) missense probably damaging 1.00
R7954:Rgs22 UTSW 15 36,082,148 (GRCm39) missense possibly damaging 0.75
R8384:Rgs22 UTSW 15 36,046,158 (GRCm39) critical splice donor site probably null
R8516:Rgs22 UTSW 15 36,010,481 (GRCm39) makesense probably null
R8904:Rgs22 UTSW 15 36,026,127 (GRCm39) missense probably damaging 1.00
R8923:Rgs22 UTSW 15 36,093,106 (GRCm39) missense probably damaging 1.00
R9287:Rgs22 UTSW 15 36,098,409 (GRCm39) missense probably damaging 1.00
R9324:Rgs22 UTSW 15 36,087,544 (GRCm39) missense probably benign
R9660:Rgs22 UTSW 15 36,040,856 (GRCm39) missense probably benign 0.08
R9679:Rgs22 UTSW 15 36,087,587 (GRCm39) missense probably benign 0.00
R9728:Rgs22 UTSW 15 36,040,856 (GRCm39) missense probably benign 0.08
RF035:Rgs22 UTSW 15 36,010,981 (GRCm39) critical splice acceptor site probably benign
RF043:Rgs22 UTSW 15 36,010,982 (GRCm39) critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GTCCAATAAATAGTCCAGTGGCTAAAC -3'
(R):5'- AGCTTTATAGTGAGACTTCAGAGTG -3'

Sequencing Primer
(F):5'- TGCTGCCTGACAACTTGAG -3'
(R):5'- GTGTAACTGACTTAAAAGGCCTCAG -3'
Posted On 2019-11-26