Incidental Mutation 'R0632:Klk1b9'
ID 59706
Institutional Source Beutler Lab
Gene Symbol Klk1b9
Ensembl Gene ENSMUSG00000059042
Gene Name kallikrein 1-related peptidase b9
Synonyms Klk9, Egfbp3, mGk-9, Egfbp-3
MMRRC Submission 038821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R0632 (G1)
Quality Score 222
Status Validated
Chromosome 7
Chromosomal Location 43976061-43980376 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 43979372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 100 (G100V)
Ref Sequence ENSEMBL: ENSMUSP00000080133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081399]
AlphaFold P15949
Predicted Effect possibly damaging
Transcript: ENSMUST00000081399
AA Change: G100V

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080133
Gene: ENSMUSG00000059042
AA Change: G100V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.54e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206787
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,227,618 D83G probably benign Het
Acaa1a T A 9: 119,347,818 probably benign Het
Adgrg7 T A 16: 56,742,589 T462S possibly damaging Het
Akap6 A T 12: 52,937,148 N825I probably damaging Het
Ankib1 T A 5: 3,772,529 N59I probably benign Het
Anks6 T C 4: 47,033,167 S633G possibly damaging Het
Ap4e1 C A 2: 127,049,280 Y522* probably null Het
Art5 G A 7: 102,097,957 T205I probably damaging Het
Ascc2 T A 11: 4,649,855 L176H probably damaging Het
Atp13a5 T C 16: 29,298,208 D529G probably benign Het
C2cd4a T C 9: 67,831,563 E66G probably benign Het
C8a T C 4: 104,856,492 D147G probably damaging Het
Ccdc109b T C 3: 129,918,726 M167V probably benign Het
Ccdc14 T C 16: 34,721,649 V532A possibly damaging Het
Ccdc88a T A 11: 29,482,749 probably benign Het
Cfap54 C T 10: 92,885,096 E2543K unknown Het
Cldn13 C T 5: 134,914,747 E195K probably benign Het
Cp A G 3: 19,971,082 S402G probably null Het
Cpa3 T C 3: 20,225,194 T194A probably benign Het
Crygf C A 1: 65,927,997 Y93* probably null Het
Ctsh A G 9: 90,061,582 R87G possibly damaging Het
Cyp2t4 A G 7: 27,158,246 D428G possibly damaging Het
Dnah17 C G 11: 118,067,682 probably benign Het
Dnah3 A G 7: 119,967,905 V2366A probably benign Het
Dscaml1 A T 9: 45,732,134 I1284F probably benign Het
Dsg1c T C 18: 20,272,346 probably benign Het
Dst G T 1: 34,271,413 R4098L probably damaging Het
Efhb A G 17: 53,413,459 probably benign Het
Epha7 A T 4: 28,821,104 I90F probably damaging Het
Fam171a2 T A 11: 102,437,881 D684V probably damaging Het
Fan1 A G 7: 64,363,199 V665A possibly damaging Het
Fbn2 A G 18: 58,037,747 C2191R probably damaging Het
Fkbp3 G A 12: 65,073,918 A2V probably benign Het
G6pd2 A G 5: 61,810,171 N430D probably benign Het
Gm13119 G A 4: 144,363,782 C464Y probably damaging Het
Gm13547 T A 2: 29,761,584 D7E possibly damaging Het
Hdac5 A T 11: 102,205,812 D260E probably damaging Het
Hist1h4i G T 13: 22,041,027 Y99* probably null Het
Hsf2bp T C 17: 32,013,346 E142G probably damaging Het
Igf1r C T 7: 68,165,155 T268I probably damaging Het
Kcne3 C T 7: 100,184,439 R88C probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lama1 C T 17: 67,752,368 probably benign Het
Lcp2 C T 11: 34,082,426 P335S possibly damaging Het
Lrrk2 T A 15: 91,796,028 N2047K probably damaging Het
Mia2 T C 12: 59,136,143 L36P probably damaging Het
Mmp13 G A 9: 7,274,032 G169R probably damaging Het
Mmp13 A T 9: 7,282,077 I460F possibly damaging Het
Msh4 A G 3: 153,896,895 I232T probably damaging Het
Msra T A 14: 64,210,532 M145L probably benign Het
Myo7a A T 7: 98,112,150 probably benign Het
Nme8 A T 13: 19,658,036 N422K probably damaging Het
Nol6 A T 4: 41,121,115 F353I probably damaging Het
Nphp3 A G 9: 104,018,274 K384E probably damaging Het
Olfr572 C T 7: 102,928,604 probably null Het
Olfr652 A G 7: 104,564,337 I39V probably benign Het
Olfr672 A G 7: 104,996,703 I67T probably benign Het
Phox2b T G 5: 67,096,214 probably benign Het
Plec A T 15: 76,173,411 S4131T probably damaging Het
Pptc7 G A 5: 122,313,591 probably benign Het
Prpf40b A G 15: 99,316,289 E810G probably benign Het
Ptprc C T 1: 138,073,610 V965I probably benign Het
Pum1 T A 4: 130,728,104 M180K probably benign Het
Ranbp3 T C 17: 56,702,896 probably benign Het
Rasgrf2 A G 13: 91,972,274 S787P probably benign Het
Rnf19b T A 4: 129,073,551 N294K probably damaging Het
Samd3 A T 10: 26,244,495 H156L possibly damaging Het
Serpinb6c C T 13: 33,880,031 R347Q possibly damaging Het
Slc36a3 A G 11: 55,125,080 I416T probably damaging Het
Slc4a4 T A 5: 89,129,641 F279Y probably damaging Het
Slc6a2 T A 8: 92,992,801 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tab2 A G 10: 7,919,801 S232P probably benign Het
Tacc2 A T 7: 130,625,595 K1356* probably null Het
Tmem87a A G 2: 120,359,542 S544P probably damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Usp38 A T 8: 81,014,150 V96E probably benign Het
Vmn2r59 T C 7: 42,058,884 Y33C probably damaging Het
Vsig10l T G 7: 43,464,137 V171G probably damaging Het
Zfp957 T A 14: 79,212,920 I480F probably damaging Het
Other mutations in Klk1b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Klk1b9 APN 7 43978454 missense probably damaging 1.00
IGL01330:Klk1b9 APN 7 43978443 nonsense probably null
IGL03329:Klk1b9 APN 7 43979414 missense probably benign 0.00
R0206:Klk1b9 UTSW 7 43979430 missense possibly damaging 0.70
R0208:Klk1b9 UTSW 7 43979430 missense possibly damaging 0.70
R1289:Klk1b9 UTSW 7 43978424 missense probably benign
R1437:Klk1b9 UTSW 7 43979690 missense probably damaging 1.00
R1994:Klk1b9 UTSW 7 43979555 missense probably benign 0.04
R5006:Klk1b9 UTSW 7 43979287 nonsense probably null
R6572:Klk1b9 UTSW 7 43979735 missense probably benign
R7149:Klk1b9 UTSW 7 43979417 missense probably benign 0.30
R7726:Klk1b9 UTSW 7 43978416 missense possibly damaging 0.47
R7911:Klk1b9 UTSW 7 43979787 missense probably damaging 1.00
R8769:Klk1b9 UTSW 7 43980242 missense probably damaging 1.00
R8914:Klk1b9 UTSW 7 43979501 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGCAGCTCTGCCTTTAGGACCTTC -3'
(R):5'- TTGCTTGGACCAGACTCACACTTG -3'

Sequencing Primer
(F):5'- GAAGTTCAGCCCTGTCCTAGC -3'
(R):5'- CTCACACTTGAAAGGTGTAGTGC -3'
Posted On 2013-07-11