Incidental Mutation 'R7749:Nckap5'
ID597068
Institutional Source Beutler Lab
Gene Symbol Nckap5
Ensembl Gene ENSMUSG00000049690
Gene NameNCK-associated protein 5
SynonymsE030049G20Rik, LOC380609, D130011D22Rik
Accession Numbers

Genbank: NM_001081756, NM_172484, NM_176957

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7749 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location125913620-126830799 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126024646 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1390 (S1390P)
Ref Sequence ENSEMBL: ENSMUSP00000125624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057846] [ENSMUST00000094609] [ENSMUST00000094610] [ENSMUST00000112583] [ENSMUST00000161954] [ENSMUST00000162877]
Predicted Effect probably damaging
Transcript: ENSMUST00000057846
AA Change: S1326P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062229
Gene: ENSMUSG00000049690
AA Change: S1326P

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 950 971 N/A INTRINSIC
low complexity region 1070 1085 N/A INTRINSIC
low complexity region 1181 1200 N/A INTRINSIC
Pfam:NCKAP5 1298 1602 1.8e-120 PFAM
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1757 1771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094609
SMART Domains Protein: ENSMUSP00000092192
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
Pfam:NCKAP5 113 364 3.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094610
SMART Domains Protein: ENSMUSP00000092193
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 1 101 8.8e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112583
AA Change: S1458P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108202
Gene: ENSMUSG00000049690
AA Change: S1458P

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
coiled coil region 176 254 N/A INTRINSIC
low complexity region 301 324 N/A INTRINSIC
low complexity region 453 464 N/A INTRINSIC
low complexity region 887 903 N/A INTRINSIC
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1202 1217 N/A INTRINSIC
low complexity region 1313 1332 N/A INTRINSIC
Pfam:NCKAP5 1431 1733 5.3e-119 PFAM
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1889 1903 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161954
AA Change: S1390P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125624
Gene: ENSMUSG00000049690
AA Change: S1390P

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 233 256 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
low complexity region 1014 1035 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1245 1264 N/A INTRINSIC
Pfam:NCKAP5 1362 1666 2.1e-120 PFAM
low complexity region 1792 1806 N/A INTRINSIC
low complexity region 1821 1835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162877
SMART Domains Protein: ENSMUSP00000124748
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 9 296 6e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (66/67)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A T 1: 134,390,512 M341L probably benign Het
Actr1a A T 19: 46,379,747 S254T probably benign Het
Adam12 G A 7: 134,224,813 A22V unknown Het
Adarb2 A G 13: 8,569,739 D87G possibly damaging Het
Aldh6a1 A T 12: 84,442,081 I59N probably benign Het
Ankrd50 C T 3: 38,482,721 C161Y probably damaging Het
Ankrd7 A G 6: 18,879,516 probably null Het
Anks1 T A 17: 28,038,141 I707N probably damaging Het
Atoh1 A T 6: 64,729,920 M200L possibly damaging Het
Bmp1 C T 14: 70,492,844 R416H probably damaging Het
Caprin1 A G 2: 103,771,754 S548P probably benign Het
Ccdc167 T A 17: 29,705,273 Y63F possibly damaging Het
Cfap99 T A 5: 34,307,940 D174E probably benign Het
Chil3 T G 3: 106,148,845 N331T probably benign Het
Chmp5 T A 4: 40,949,488 I35N probably damaging Het
Cpt1c A T 7: 44,962,265 S537T probably benign Het
Dctn1 A T 6: 83,186,141 probably benign Het
Dhx57 T A 17: 80,238,858 M1366L probably benign Het
Dnah9 T A 11: 65,911,830 Y3478F probably damaging Het
Efna3 A G 3: 89,316,640 Y81H probably damaging Het
Eif4enif1 T C 11: 3,242,608 V812A probably damaging Het
Erg A T 16: 95,377,357 I237N probably benign Het
Fem1c G T 18: 46,524,118 N176K probably damaging Het
Fgd4 T C 16: 16,475,154 Y233C probably benign Het
Foxd2 G A 4: 114,907,812 A337V unknown Het
Gsdma2 T C 11: 98,657,721 L433P unknown Het
Hmcn2 C A 2: 31,453,033 probably null Het
Hnrnpul2 T C 19: 8,820,424 V48A probably benign Het
Hsf1 T A 15: 76,499,187 S396T probably benign Het
Htr5b G T 1: 121,527,758 N144K probably damaging Het
Igkv9-120 T C 6: 68,050,188 S29P probably damaging Het
Igsf10 T A 3: 59,329,128 N1211Y possibly damaging Het
Kcnh1 A C 1: 192,277,139 I334L probably benign Het
Laptm4b T C 15: 34,276,200 I158T probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,703,352 T2063A probably damaging Het
Nceh1 T A 3: 27,207,382 D47E probably benign Het
Npepps T G 11: 97,267,628 I104L probably benign Het
Numb A G 12: 83,801,277 S229P not run Het
Olfr1156 G A 2: 87,949,478 H252Y probably damaging Het
Olfr1342 T C 4: 118,690,228 S75G probably damaging Het
Olfr1443 A T 19: 12,680,212 I35F probably benign Het
Opn1sw T A 6: 29,380,169 I83F probably benign Het
Pigg T G 5: 108,336,296 C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 C A 15: 44,527,737 H1504N probably benign Het
Plcd4 A G 1: 74,565,133 N757D possibly damaging Het
Ppia A G 11: 6,419,569 T152A probably benign Het
Psmd8 G A 7: 29,178,921 probably null Het
Pxn T A 5: 115,548,516 Y356N probably benign Het
Rhoa G C 9: 108,336,715 C159S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rita1 C T 5: 120,611,441 C69Y probably benign Het
Satb1 A G 17: 51,767,933 S512P possibly damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Slc22a6 A G 19: 8,621,896 K297R possibly damaging Het
Snrnp48 T C 13: 38,221,287 Y287H probably benign Het
Sntg2 A T 12: 30,226,911 C381S probably benign Het
Syngap1 T A 17: 26,959,964 M649K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thap2 T C 10: 115,376,384 I79V probably damaging Het
Thap7 T C 16: 17,528,603 N172S probably benign Het
Ticrr A G 7: 79,679,096 Y661C possibly damaging Het
Ttn T C 2: 76,776,315 N18084D probably damaging Het
Usp48 A T 4: 137,650,417 K1020M probably damaging Het
Vmn2r12 T C 5: 109,086,054 N764S probably damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Wfdc6b T A 2: 164,617,419 C134S probably damaging Het
Zcchc2 A T 1: 106,018,273 D481V probably damaging Het
Zfp949 G A 9: 88,569,870 G498R probably damaging Het
Other mutations in Nckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nckap5 APN 1 126027152 missense probably damaging 0.99
IGL00956:Nckap5 APN 1 126025018 missense probably damaging 0.98
IGL01414:Nckap5 APN 1 126528713 missense probably damaging 1.00
IGL01482:Nckap5 APN 1 126023160 missense probably damaging 1.00
IGL01508:Nckap5 APN 1 126025572 missense probably damaging 0.96
IGL02071:Nckap5 APN 1 125981568 missense probably damaging 0.97
IGL02129:Nckap5 APN 1 126027695 nonsense probably null
IGL02821:Nckap5 APN 1 126027816 missense probably damaging 1.00
IGL03174:Nckap5 APN 1 125981646 missense probably damaging 1.00
F5493:Nckap5 UTSW 1 126025827 missense probably benign
G5030:Nckap5 UTSW 1 126025854 missense probably damaging 0.96
R0033:Nckap5 UTSW 1 125940242 intron probably benign
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0349:Nckap5 UTSW 1 126026434 missense probably benign
R0482:Nckap5 UTSW 1 126026365 missense possibly damaging 0.92
R0508:Nckap5 UTSW 1 125981384 splice site probably null
R0541:Nckap5 UTSW 1 126695722 missense possibly damaging 0.82
R0609:Nckap5 UTSW 1 126027288 nonsense probably null
R0701:Nckap5 UTSW 1 126025357 missense probably benign 0.06
R0782:Nckap5 UTSW 1 125981541 missense probably damaging 1.00
R1389:Nckap5 UTSW 1 126026710 missense probably damaging 0.99
R1401:Nckap5 UTSW 1 126014661 splice site probably benign
R1436:Nckap5 UTSW 1 126026061 missense possibly damaging 0.96
R1506:Nckap5 UTSW 1 126025913 nonsense probably null
R1528:Nckap5 UTSW 1 126024922 missense possibly damaging 0.68
R1942:Nckap5 UTSW 1 126024302 missense probably damaging 1.00
R1968:Nckap5 UTSW 1 126014630 missense probably damaging 0.99
R2055:Nckap5 UTSW 1 126026898 missense probably damaging 1.00
R2105:Nckap5 UTSW 1 126026518 missense probably damaging 1.00
R2214:Nckap5 UTSW 1 126025750 missense possibly damaging 0.77
R2311:Nckap5 UTSW 1 126528752 missense probably damaging 1.00
R2403:Nckap5 UTSW 1 126027409 missense probably benign 0.18
R2430:Nckap5 UTSW 1 125914757 missense probably damaging 0.99
R2914:Nckap5 UTSW 1 126026537 unclassified probably null
R3782:Nckap5 UTSW 1 126025074 missense possibly damaging 0.93
R4133:Nckap5 UTSW 1 126222706 missense probably benign 0.13
R4249:Nckap5 UTSW 1 126027639 missense probably benign 0.01
R4448:Nckap5 UTSW 1 126025726 nonsense probably null
R4456:Nckap5 UTSW 1 125914735 unclassified probably benign
R4682:Nckap5 UTSW 1 126102542 critical splice donor site probably null
R4817:Nckap5 UTSW 1 126027215 missense possibly damaging 0.68
R4907:Nckap5 UTSW 1 126026152 missense possibly damaging 0.92
R4908:Nckap5 UTSW 1 126027587 missense probably damaging 1.00
R4924:Nckap5 UTSW 1 126027028 nonsense probably null
R4926:Nckap5 UTSW 1 126528641 intron probably benign
R5032:Nckap5 UTSW 1 125977049 missense possibly damaging 0.62
R5133:Nckap5 UTSW 1 126033960 missense probably benign 0.01
R5197:Nckap5 UTSW 1 126222673 missense possibly damaging 0.79
R5238:Nckap5 UTSW 1 126027724 missense probably damaging 0.96
R5257:Nckap5 UTSW 1 126024508 missense probably damaging 0.99
R5277:Nckap5 UTSW 1 126026540 nonsense probably null
R5512:Nckap5 UTSW 1 126027744 missense possibly damaging 0.63
R5700:Nckap5 UTSW 1 125976925 critical splice donor site probably null
R5789:Nckap5 UTSW 1 126027702 missense probably damaging 1.00
R6029:Nckap5 UTSW 1 126025786 missense possibly damaging 0.89
R6249:Nckap5 UTSW 1 126024930 missense probably benign
R6292:Nckap5 UTSW 1 125915015 missense probably damaging 0.99
R6521:Nckap5 UTSW 1 126382172 missense probably damaging 1.00
R6875:Nckap5 UTSW 1 126023194 missense probably benign 0.03
R7017:Nckap5 UTSW 1 126102661 missense probably damaging 1.00
R7018:Nckap5 UTSW 1 126025048 missense probably damaging 0.99
R7054:Nckap5 UTSW 1 126258712 intron probably null
R7204:Nckap5 UTSW 1 126026367 missense probably benign
R7336:Nckap5 UTSW 1 126026049 missense probably benign 0.00
R7544:Nckap5 UTSW 1 126026211 missense possibly damaging 0.92
R7590:Nckap5 UTSW 1 126026533 missense probably benign 0.00
R7684:Nckap5 UTSW 1 126026857 missense probably benign 0.00
R7773:Nckap5 UTSW 1 126026844 missense probably benign 0.00
R7813:Nckap5 UTSW 1 126025426 missense probably benign 0.10
Z1088:Nckap5 UTSW 1 126024832 missense possibly damaging 0.76
Z1176:Nckap5 UTSW 1 126528681 critical splice donor site probably null
Z1177:Nckap5 UTSW 1 126222659 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGGACTCTGACCATCTGC -3'
(R):5'- TCAGTTCCTGCACGTTCCAG -3'

Sequencing Primer
(F):5'- GACTCTGACCATCTGCCTTCTTGG -3'
(R):5'- GCAGCGCCCAAGCAATTTG -3'
Posted On2019-11-26