Incidental Mutation 'R7749:4933406M09Rik'
ID 597069
Institutional Source Beutler Lab
Gene Symbol 4933406M09Rik
Ensembl Gene ENSMUSG00000050526
Gene Name RIKEN cDNA 4933406M09 gene
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_173771.4; MGI: 3045320

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7749 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 134385940-134390981 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 134390512 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 341 (M341L)
Ref Sequence ENSEMBL: ENSMUSP00000124251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162187]
AlphaFold G3XA12
Predicted Effect probably benign
Transcript: ENSMUST00000162187
AA Change: M341L

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124251
Gene: ENSMUSG00000050526
AA Change: M341L

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 52 326 7.6e-79 PFAM
low complexity region 395 405 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (66/67)
Allele List at MGI

All alleles(6) : Targeted(2) Gene trapped(4)

 

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1a A T 19: 46,379,747 S254T probably benign Het
Adam12 G A 7: 134,224,813 A22V unknown Het
Adarb2 A G 13: 8,569,739 D87G possibly damaging Het
Aldh6a1 A T 12: 84,442,081 I59N probably benign Het
Ankrd50 C T 3: 38,482,721 C161Y probably damaging Het
Ankrd7 A G 6: 18,879,516 probably null Het
Anks1 T A 17: 28,038,141 I707N probably damaging Het
Atoh1 A T 6: 64,729,920 M200L possibly damaging Het
Bmp1 C T 14: 70,492,844 R416H probably damaging Het
Caprin1 A G 2: 103,771,754 S548P probably benign Het
Ccdc167 T A 17: 29,705,273 Y63F possibly damaging Het
Cfap99 T A 5: 34,307,940 D174E probably benign Het
Chil3 T G 3: 106,148,845 N331T probably benign Het
Chmp5 T A 4: 40,949,488 I35N probably damaging Het
Cpt1c A T 7: 44,962,265 S537T probably benign Het
Dctn1 A T 6: 83,186,141 probably benign Het
Dhx57 T A 17: 80,238,858 M1366L probably benign Het
Dnah9 T A 11: 65,911,830 Y3478F probably damaging Het
Efna3 A G 3: 89,316,640 Y81H probably damaging Het
Eif4enif1 T C 11: 3,242,608 V812A probably damaging Het
Erg A T 16: 95,377,357 I237N probably benign Het
Fem1c G T 18: 46,524,118 N176K probably damaging Het
Fgd4 T C 16: 16,475,154 Y233C probably benign Het
Foxd2 G A 4: 114,907,812 A337V unknown Het
Gsdma2 T C 11: 98,657,721 L433P unknown Het
Hmcn2 C A 2: 31,453,033 probably null Het
Hnrnpul2 T C 19: 8,820,424 V48A probably benign Het
Hsf1 T A 15: 76,499,187 S396T probably benign Het
Htr5b G T 1: 121,527,758 N144K probably damaging Het
Igkv9-120 T C 6: 68,050,188 S29P probably damaging Het
Igsf10 T A 3: 59,329,128 N1211Y possibly damaging Het
Kcnh1 A C 1: 192,277,139 I334L probably benign Het
Laptm4b T C 15: 34,276,200 I158T probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,703,352 T2063A probably damaging Het
Nceh1 T A 3: 27,207,382 D47E probably benign Het
Nckap5 A G 1: 126,024,646 S1390P probably damaging Het
Npepps T G 11: 97,267,628 I104L probably benign Het
Numb A G 12: 83,801,277 S229P not run Het
Olfr1156 G A 2: 87,949,478 H252Y probably damaging Het
Olfr1342 T C 4: 118,690,228 S75G probably damaging Het
Olfr1443 A T 19: 12,680,212 I35F probably benign Het
Opn1sw T A 6: 29,380,169 I83F probably benign Het
Pigg T G 5: 108,336,296 C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 C A 15: 44,527,737 H1504N probably benign Het
Plcd4 A G 1: 74,565,133 N757D possibly damaging Het
Ppia A G 11: 6,419,569 T152A probably benign Het
Psmd8 G A 7: 29,178,921 probably null Het
Pxn T A 5: 115,548,516 Y356N probably benign Het
Rhoa G C 9: 108,336,715 C159S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rita1 C T 5: 120,611,441 C69Y probably benign Het
Satb1 A G 17: 51,767,933 S512P possibly damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Slc22a6 A G 19: 8,621,896 K297R possibly damaging Het
Snrnp48 T C 13: 38,221,287 Y287H probably benign Het
Sntg2 A T 12: 30,226,911 C381S probably benign Het
Syngap1 T A 17: 26,959,964 M649K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thap2 T C 10: 115,376,384 I79V probably damaging Het
Thap7 T C 16: 17,528,603 N172S probably benign Het
Ticrr A G 7: 79,679,096 Y661C possibly damaging Het
Ttn T C 2: 76,776,315 N18084D probably damaging Het
Usp48 A T 4: 137,650,417 K1020M probably damaging Het
Vmn2r12 T C 5: 109,086,054 N764S probably damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Wfdc6b T A 2: 164,617,419 C134S probably damaging Het
Zcchc2 A T 1: 106,018,273 D481V probably damaging Het
Zfp949 G A 9: 88,569,870 G498R probably damaging Het
Other mutations in 4933406M09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:4933406M09Rik APN 1 134389958 missense probably damaging 1.00
IGL01862:4933406M09Rik APN 1 134390611 missense probably benign 0.03
P0005:4933406M09Rik UTSW 1 134387908 missense probably benign 0.00
R0498:4933406M09Rik UTSW 1 134390872 missense possibly damaging 0.69
R0563:4933406M09Rik UTSW 1 134390039 missense probably benign 0.00
R0731:4933406M09Rik UTSW 1 134389975 missense probably benign
R1558:4933406M09Rik UTSW 1 134390774 missense probably damaging 1.00
R2146:4933406M09Rik UTSW 1 134390513 missense probably damaging 1.00
R2148:4933406M09Rik UTSW 1 134390513 missense probably damaging 1.00
R2901:4933406M09Rik UTSW 1 134390924 missense probably damaging 0.99
R3897:4933406M09Rik UTSW 1 134390438 missense possibly damaging 0.92
R4543:4933406M09Rik UTSW 1 134389793 missense probably benign 0.31
R4937:4933406M09Rik UTSW 1 134389976 missense probably benign 0.00
R5490:4933406M09Rik UTSW 1 134389928 missense probably damaging 1.00
R5684:4933406M09Rik UTSW 1 134389922 missense probably benign 0.04
R5823:4933406M09Rik UTSW 1 134390917 missense probably damaging 0.98
R6488:4933406M09Rik UTSW 1 134390888 missense probably damaging 1.00
R7177:4933406M09Rik UTSW 1 134390425 missense probably benign 0.08
R7201:4933406M09Rik UTSW 1 134390468 missense possibly damaging 0.69
R7671:4933406M09Rik UTSW 1 134390062 missense probably benign 0.27
R8385:4933406M09Rik UTSW 1 134390638 missense probably benign 0.00
R9393:4933406M09Rik UTSW 1 134390858 missense probably benign 0.02
Z1177:4933406M09Rik UTSW 1 134390158 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCTCTCTGAGTTCAGGC -3'
(R):5'- TAATGAGCACAGCGTTGGG -3'

Sequencing Primer
(F):5'- CAGGCTTCTCTTGTCTCAAAATG -3'
(R):5'- GTAGCCCAGTAATAGTTGCCCATG -3'
Posted On 2019-11-26