Incidental Mutation 'R7749:Taf4'
ID 597075
Institutional Source Beutler Lab
Gene Symbol Taf4
Ensembl Gene ENSMUSG00000039117
Gene Name TATA-box binding protein associated factor 4
Synonyms TAFII130, Taf2c1, TAFII135, Taf4a
MMRRC Submission 045805-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7749 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 179553945-179618439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 179573822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 682 (T682M)
Ref Sequence ENSEMBL: ENSMUSP00000153863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041618] [ENSMUST00000227325]
AlphaFold E9QAP7
Predicted Effect probably damaging
Transcript: ENSMUST00000041618
AA Change: T682M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038610
Gene: ENSMUSG00000039117
AA Change: T682M

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 64 181 N/A INTRINSIC
SCOP:d1hqva_ 312 325 6e-3 SMART
low complexity region 339 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
internal_repeat_1 465 500 2.85e-5 PROSPERO
low complexity region 537 547 N/A INTRINSIC
TAFH 550 642 4.9e-54 SMART
internal_repeat_1 692 727 2.85e-5 PROSPERO
low complexity region 767 773 N/A INTRINSIC
Pfam:TAF4 791 1039 3.5e-81 PFAM
Predicted Effect not run
Transcript: ENSMUST00000131358
AA Change: T319M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154961
Predicted Effect probably damaging
Transcript: ENSMUST00000227325
AA Change: T682M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2230 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that has been shown to potentiate transcriptional activation by retinoic acid, thyroid hormone and vitamin D3 receptors. In addition, this subunit interacts with the transcription factor CREB, which has a glutamine-rich activation domain, and binds to other proteins containing glutamine-rich regions. Aberrant binding to this subunit by proteins with expanded polyglutamine regions has been suggested as one of the pathogenetic mechanisms underlying a group of neurodegenerative disorders referred to as polyglutamine diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletions of this marker die embryonically sometime around E9.5. Conditional expression of this allele in the epidermis causes skin barrier defects and defects in hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1a A T 19: 46,368,186 (GRCm39) S254T probably benign Het
Adam12 G A 7: 133,826,542 (GRCm39) A22V unknown Het
Adarb2 A G 13: 8,619,775 (GRCm39) D87G possibly damaging Het
Aldh6a1 A T 12: 84,488,855 (GRCm39) I59N probably benign Het
Ankrd50 C T 3: 38,536,870 (GRCm39) C161Y probably damaging Het
Ankrd7 A G 6: 18,879,515 (GRCm39) probably null Het
Anks1 T A 17: 28,257,115 (GRCm39) I707N probably damaging Het
Atoh1 A T 6: 64,706,904 (GRCm39) M200L possibly damaging Het
Bmp1 C T 14: 70,730,284 (GRCm39) R416H probably damaging Het
Caprin1 A G 2: 103,602,099 (GRCm39) S548P probably benign Het
Ccdc167 T A 17: 29,924,247 (GRCm39) Y63F possibly damaging Het
Cfap99 T A 5: 34,465,284 (GRCm39) D174E probably benign Het
Chil3 T G 3: 106,056,161 (GRCm39) N331T probably benign Het
Chmp5 T A 4: 40,949,488 (GRCm39) I35N probably damaging Het
Cpt1c A T 7: 44,611,689 (GRCm39) S537T probably benign Het
Dctn1 A T 6: 83,163,123 (GRCm39) probably benign Het
Dhx57 T A 17: 80,546,287 (GRCm39) M1366L probably benign Het
Dnah9 T A 11: 65,802,656 (GRCm39) Y3478F probably damaging Het
Efna3 A G 3: 89,223,947 (GRCm39) Y81H probably damaging Het
Eif4enif1 T C 11: 3,192,608 (GRCm39) V812A probably damaging Het
Erg A T 16: 95,178,216 (GRCm39) I237N probably benign Het
Fem1c G T 18: 46,657,185 (GRCm39) N176K probably damaging Het
Fgd4 T C 16: 16,293,018 (GRCm39) Y233C probably benign Het
Foxd2 G A 4: 114,765,009 (GRCm39) A337V unknown Het
Gsdma2 T C 11: 98,548,547 (GRCm39) L433P unknown Het
Hmcn2 C A 2: 31,343,045 (GRCm39) probably null Het
Hnrnpul2 T C 19: 8,797,788 (GRCm39) V48A probably benign Het
Hsf1 T A 15: 76,383,387 (GRCm39) S396T probably benign Het
Htr5b G T 1: 121,455,487 (GRCm39) N144K probably damaging Het
Igkv9-120 T C 6: 68,027,172 (GRCm39) S29P probably damaging Het
Igsf10 T A 3: 59,236,549 (GRCm39) N1211Y possibly damaging Het
Kcnh1 A C 1: 191,959,447 (GRCm39) I334L probably benign Het
Laptm4b T C 15: 34,276,346 (GRCm39) I158T probably benign Het
Mgat4f A T 1: 134,318,250 (GRCm39) M341L probably benign Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nav3 T C 10: 109,539,213 (GRCm39) T2063A probably damaging Het
Nceh1 T A 3: 27,261,531 (GRCm39) D47E probably benign Het
Nckap5 A G 1: 125,952,383 (GRCm39) S1390P probably damaging Het
Npepps T G 11: 97,158,454 (GRCm39) I104L probably benign Het
Numb A G 12: 83,848,051 (GRCm39) S229P not run Het
Opn1sw T A 6: 29,380,168 (GRCm39) I83F probably benign Het
Or13p4 T C 4: 118,547,425 (GRCm39) S75G probably damaging Het
Or5b95 A T 19: 12,657,576 (GRCm39) I35F probably benign Het
Or5l13 G A 2: 87,779,822 (GRCm39) H252Y probably damaging Het
Pigg T G 5: 108,484,162 (GRCm39) C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pkhd1l1 C A 15: 44,391,133 (GRCm39) H1504N probably benign Het
Plcd4 A G 1: 74,604,292 (GRCm39) N757D possibly damaging Het
Ppia A G 11: 6,369,569 (GRCm39) T152A probably benign Het
Psmd8 G A 7: 28,878,346 (GRCm39) probably null Het
Pxn T A 5: 115,686,575 (GRCm39) Y356N probably benign Het
Rhoa G C 9: 108,213,914 (GRCm39) C159S probably damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rita1 C T 5: 120,749,506 (GRCm39) C69Y probably benign Het
Satb1 A G 17: 52,074,961 (GRCm39) S512P possibly damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Slc22a6 A G 19: 8,599,260 (GRCm39) K297R possibly damaging Het
Snrnp48 T C 13: 38,405,263 (GRCm39) Y287H probably benign Het
Sntg2 A T 12: 30,276,910 (GRCm39) C381S probably benign Het
Syngap1 T A 17: 27,178,938 (GRCm39) M649K probably damaging Het
Thap2 T C 10: 115,212,289 (GRCm39) I79V probably damaging Het
Thap7 T C 16: 17,346,467 (GRCm39) N172S probably benign Het
Ticrr A G 7: 79,328,844 (GRCm39) Y661C possibly damaging Het
Ttn T C 2: 76,606,659 (GRCm39) N18084D probably damaging Het
Usp48 A T 4: 137,377,728 (GRCm39) K1020M probably damaging Het
Vmn2r12 T C 5: 109,233,920 (GRCm39) N764S probably damaging Het
Vmn2r91 A G 17: 18,356,540 (GRCm39) I736V possibly damaging Het
Wfdc6b T A 2: 164,459,339 (GRCm39) C134S probably damaging Het
Zcchc2 A T 1: 105,946,003 (GRCm39) D481V probably damaging Het
Zfp949 G A 9: 88,451,923 (GRCm39) G498R probably damaging Het
Other mutations in Taf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Taf4 APN 2 179,618,418 (GRCm39) missense unknown
IGL00517:Taf4 APN 2 179,566,206 (GRCm39) splice site probably benign
IGL02159:Taf4 APN 2 179,580,263 (GRCm39) missense probably benign 0.24
IGL02254:Taf4 APN 2 179,562,977 (GRCm39) missense probably benign 0.25
IGL03366:Taf4 APN 2 179,576,847 (GRCm39) missense probably damaging 1.00
R0049:Taf4 UTSW 2 179,565,884 (GRCm39) missense probably damaging 0.98
R0049:Taf4 UTSW 2 179,565,884 (GRCm39) missense probably damaging 0.98
R1267:Taf4 UTSW 2 179,571,117 (GRCm39) missense possibly damaging 0.46
R1495:Taf4 UTSW 2 179,574,820 (GRCm39) missense probably damaging 1.00
R1560:Taf4 UTSW 2 179,577,746 (GRCm39) missense probably benign 0.14
R1756:Taf4 UTSW 2 179,618,324 (GRCm39) missense unknown
R1893:Taf4 UTSW 2 179,574,823 (GRCm39) missense probably damaging 0.98
R1932:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R2213:Taf4 UTSW 2 179,577,683 (GRCm39) critical splice donor site probably null
R3896:Taf4 UTSW 2 179,573,807 (GRCm39) missense probably benign 0.45
R4050:Taf4 UTSW 2 179,573,805 (GRCm39) missense probably damaging 1.00
R4448:Taf4 UTSW 2 179,577,764 (GRCm39) missense possibly damaging 0.65
R4736:Taf4 UTSW 2 179,566,287 (GRCm39) missense probably damaging 1.00
R5124:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R6155:Taf4 UTSW 2 179,555,317 (GRCm39) missense probably damaging 1.00
R6238:Taf4 UTSW 2 179,573,832 (GRCm39) missense probably damaging 0.97
R6292:Taf4 UTSW 2 179,565,780 (GRCm39) missense probably damaging 1.00
R7751:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7752:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7754:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7835:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7879:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7880:Taf4 UTSW 2 179,577,726 (GRCm39) nonsense probably null
R7880:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7883:Taf4 UTSW 2 179,571,088 (GRCm39) missense probably damaging 1.00
R7899:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7902:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R7905:Taf4 UTSW 2 179,573,822 (GRCm39) missense probably damaging 1.00
R9743:Taf4 UTSW 2 179,581,592 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACACGTCTTTCCAGCAGGAG -3'
(R):5'- AATGTTCCAGCTGTGCCTGAC -3'

Sequencing Primer
(F):5'- GGAGCTTCCTTGCCTGC -3'
(R):5'- AGCTTACCTGCCTTGAGACAG -3'
Posted On 2019-11-26