Incidental Mutation 'R7749:Vmn2r12'
ID 597086
Institutional Source Beutler Lab
Gene Symbol Vmn2r12
Ensembl Gene ENSMUSG00000090688
Gene Name vomeronasal 2, receptor 12
Synonyms Gm6769
MMRRC Submission 045805-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7749 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 109233715-109245730 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109233920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 764 (N764S)
Ref Sequence ENSEMBL: ENSMUSP00000093612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095922]
AlphaFold L7N217
Predicted Effect probably damaging
Transcript: ENSMUST00000095922
AA Change: N764S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: N764S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.8e-30 PFAM
Pfam:NCD3G 505 559 1.7e-18 PFAM
Pfam:7tm_3 591 827 3.9e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1a A T 19: 46,368,186 (GRCm39) S254T probably benign Het
Adam12 G A 7: 133,826,542 (GRCm39) A22V unknown Het
Adarb2 A G 13: 8,619,775 (GRCm39) D87G possibly damaging Het
Aldh6a1 A T 12: 84,488,855 (GRCm39) I59N probably benign Het
Ankrd50 C T 3: 38,536,870 (GRCm39) C161Y probably damaging Het
Ankrd7 A G 6: 18,879,515 (GRCm39) probably null Het
Anks1 T A 17: 28,257,115 (GRCm39) I707N probably damaging Het
Atoh1 A T 6: 64,706,904 (GRCm39) M200L possibly damaging Het
Bmp1 C T 14: 70,730,284 (GRCm39) R416H probably damaging Het
Caprin1 A G 2: 103,602,099 (GRCm39) S548P probably benign Het
Ccdc167 T A 17: 29,924,247 (GRCm39) Y63F possibly damaging Het
Cfap99 T A 5: 34,465,284 (GRCm39) D174E probably benign Het
Chil3 T G 3: 106,056,161 (GRCm39) N331T probably benign Het
Chmp5 T A 4: 40,949,488 (GRCm39) I35N probably damaging Het
Cpt1c A T 7: 44,611,689 (GRCm39) S537T probably benign Het
Dctn1 A T 6: 83,163,123 (GRCm39) probably benign Het
Dhx57 T A 17: 80,546,287 (GRCm39) M1366L probably benign Het
Dnah9 T A 11: 65,802,656 (GRCm39) Y3478F probably damaging Het
Efna3 A G 3: 89,223,947 (GRCm39) Y81H probably damaging Het
Eif4enif1 T C 11: 3,192,608 (GRCm39) V812A probably damaging Het
Erg A T 16: 95,178,216 (GRCm39) I237N probably benign Het
Fem1c G T 18: 46,657,185 (GRCm39) N176K probably damaging Het
Fgd4 T C 16: 16,293,018 (GRCm39) Y233C probably benign Het
Foxd2 G A 4: 114,765,009 (GRCm39) A337V unknown Het
Gsdma2 T C 11: 98,548,547 (GRCm39) L433P unknown Het
Hmcn2 C A 2: 31,343,045 (GRCm39) probably null Het
Hnrnpul2 T C 19: 8,797,788 (GRCm39) V48A probably benign Het
Hsf1 T A 15: 76,383,387 (GRCm39) S396T probably benign Het
Htr5b G T 1: 121,455,487 (GRCm39) N144K probably damaging Het
Igkv9-120 T C 6: 68,027,172 (GRCm39) S29P probably damaging Het
Igsf10 T A 3: 59,236,549 (GRCm39) N1211Y possibly damaging Het
Kcnh1 A C 1: 191,959,447 (GRCm39) I334L probably benign Het
Laptm4b T C 15: 34,276,346 (GRCm39) I158T probably benign Het
Mgat4f A T 1: 134,318,250 (GRCm39) M341L probably benign Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nav3 T C 10: 109,539,213 (GRCm39) T2063A probably damaging Het
Nceh1 T A 3: 27,261,531 (GRCm39) D47E probably benign Het
Nckap5 A G 1: 125,952,383 (GRCm39) S1390P probably damaging Het
Npepps T G 11: 97,158,454 (GRCm39) I104L probably benign Het
Numb A G 12: 83,848,051 (GRCm39) S229P not run Het
Opn1sw T A 6: 29,380,168 (GRCm39) I83F probably benign Het
Or13p4 T C 4: 118,547,425 (GRCm39) S75G probably damaging Het
Or5b95 A T 19: 12,657,576 (GRCm39) I35F probably benign Het
Or5l13 G A 2: 87,779,822 (GRCm39) H252Y probably damaging Het
Pigg T G 5: 108,484,162 (GRCm39) C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pkhd1l1 C A 15: 44,391,133 (GRCm39) H1504N probably benign Het
Plcd4 A G 1: 74,604,292 (GRCm39) N757D possibly damaging Het
Ppia A G 11: 6,369,569 (GRCm39) T152A probably benign Het
Psmd8 G A 7: 28,878,346 (GRCm39) probably null Het
Pxn T A 5: 115,686,575 (GRCm39) Y356N probably benign Het
Rhoa G C 9: 108,213,914 (GRCm39) C159S probably damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rita1 C T 5: 120,749,506 (GRCm39) C69Y probably benign Het
Satb1 A G 17: 52,074,961 (GRCm39) S512P possibly damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Slc22a6 A G 19: 8,599,260 (GRCm39) K297R possibly damaging Het
Snrnp48 T C 13: 38,405,263 (GRCm39) Y287H probably benign Het
Sntg2 A T 12: 30,276,910 (GRCm39) C381S probably benign Het
Syngap1 T A 17: 27,178,938 (GRCm39) M649K probably damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Thap2 T C 10: 115,212,289 (GRCm39) I79V probably damaging Het
Thap7 T C 16: 17,346,467 (GRCm39) N172S probably benign Het
Ticrr A G 7: 79,328,844 (GRCm39) Y661C possibly damaging Het
Ttn T C 2: 76,606,659 (GRCm39) N18084D probably damaging Het
Usp48 A T 4: 137,377,728 (GRCm39) K1020M probably damaging Het
Vmn2r91 A G 17: 18,356,540 (GRCm39) I736V possibly damaging Het
Wfdc6b T A 2: 164,459,339 (GRCm39) C134S probably damaging Het
Zcchc2 A T 1: 105,946,003 (GRCm39) D481V probably damaging Het
Zfp949 G A 9: 88,451,923 (GRCm39) G498R probably damaging Het
Other mutations in Vmn2r12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn2r12 APN 5 109,245,541 (GRCm39) missense possibly damaging 0.47
IGL01096:Vmn2r12 APN 5 109,234,125 (GRCm39) missense probably damaging 1.00
IGL01538:Vmn2r12 APN 5 109,239,716 (GRCm39) missense probably damaging 1.00
IGL01548:Vmn2r12 APN 5 109,240,893 (GRCm39) nonsense probably null
IGL01762:Vmn2r12 APN 5 109,234,430 (GRCm39) missense probably damaging 0.99
IGL01860:Vmn2r12 APN 5 109,240,025 (GRCm39) missense probably benign 0.10
IGL02269:Vmn2r12 APN 5 109,234,343 (GRCm39) missense probably damaging 1.00
IGL02530:Vmn2r12 APN 5 109,233,858 (GRCm39) missense probably damaging 1.00
IGL02887:Vmn2r12 APN 5 109,238,351 (GRCm39) missense probably benign 0.03
IGL03265:Vmn2r12 APN 5 109,239,936 (GRCm39) missense probably benign 0.05
R0396:Vmn2r12 UTSW 5 109,240,765 (GRCm39) missense probably benign 0.00
R0497:Vmn2r12 UTSW 5 109,239,755 (GRCm39) nonsense probably null
R0529:Vmn2r12 UTSW 5 109,240,714 (GRCm39) missense probably benign
R0715:Vmn2r12 UTSW 5 109,238,373 (GRCm39) missense probably benign 0.10
R0742:Vmn2r12 UTSW 5 109,234,281 (GRCm39) missense possibly damaging 0.55
R0894:Vmn2r12 UTSW 5 109,235,716 (GRCm39) critical splice donor site probably null
R1173:Vmn2r12 UTSW 5 109,240,720 (GRCm39) missense probably benign 0.00
R1174:Vmn2r12 UTSW 5 109,240,720 (GRCm39) missense probably benign 0.00
R1259:Vmn2r12 UTSW 5 109,239,763 (GRCm39) missense probably damaging 0.97
R1349:Vmn2r12 UTSW 5 109,234,452 (GRCm39) missense probably benign 0.00
R1388:Vmn2r12 UTSW 5 109,240,840 (GRCm39) missense possibly damaging 0.56
R1549:Vmn2r12 UTSW 5 109,240,696 (GRCm39) missense probably benign 0.06
R1766:Vmn2r12 UTSW 5 109,239,910 (GRCm39) missense probably damaging 1.00
R1781:Vmn2r12 UTSW 5 109,239,594 (GRCm39) missense probably benign 0.00
R1885:Vmn2r12 UTSW 5 109,239,942 (GRCm39) missense probably damaging 1.00
R2159:Vmn2r12 UTSW 5 109,239,340 (GRCm39) missense probably benign 0.02
R2420:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2421:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2422:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2937:Vmn2r12 UTSW 5 109,239,397 (GRCm39) missense probably damaging 1.00
R2938:Vmn2r12 UTSW 5 109,239,397 (GRCm39) missense probably damaging 1.00
R3898:Vmn2r12 UTSW 5 109,238,370 (GRCm39) missense probably benign 0.02
R4061:Vmn2r12 UTSW 5 109,240,058 (GRCm39) missense possibly damaging 0.95
R4063:Vmn2r12 UTSW 5 109,240,058 (GRCm39) missense possibly damaging 0.95
R4090:Vmn2r12 UTSW 5 109,239,412 (GRCm39) missense probably benign 0.06
R4297:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4298:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4299:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4304:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4306:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4307:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4308:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4594:Vmn2r12 UTSW 5 109,234,301 (GRCm39) missense probably damaging 1.00
R4783:Vmn2r12 UTSW 5 109,234,379 (GRCm39) missense probably damaging 1.00
R4900:Vmn2r12 UTSW 5 109,240,852 (GRCm39) missense probably damaging 1.00
R4929:Vmn2r12 UTSW 5 109,239,544 (GRCm39) missense probably damaging 1.00
R4974:Vmn2r12 UTSW 5 109,239,372 (GRCm39) missense probably damaging 1.00
R5389:Vmn2r12 UTSW 5 109,238,261 (GRCm39) missense probably benign 0.00
R5431:Vmn2r12 UTSW 5 109,239,684 (GRCm39) missense probably damaging 0.99
R5527:Vmn2r12 UTSW 5 109,234,483 (GRCm39) nonsense probably null
R5639:Vmn2r12 UTSW 5 109,240,666 (GRCm39) missense probably benign 0.06
R5753:Vmn2r12 UTSW 5 109,239,670 (GRCm39) missense probably damaging 1.00
R5797:Vmn2r12 UTSW 5 109,233,736 (GRCm39) nonsense probably null
R6142:Vmn2r12 UTSW 5 109,240,763 (GRCm39) missense probably benign
R6162:Vmn2r12 UTSW 5 109,234,430 (GRCm39) missense probably damaging 0.99
R6176:Vmn2r12 UTSW 5 109,233,866 (GRCm39) missense probably benign 0.43
R6853:Vmn2r12 UTSW 5 109,240,771 (GRCm39) missense probably damaging 1.00
R7238:Vmn2r12 UTSW 5 109,245,655 (GRCm39) missense possibly damaging 0.81
R7341:Vmn2r12 UTSW 5 109,239,811 (GRCm39) missense possibly damaging 0.95
R7341:Vmn2r12 UTSW 5 109,234,113 (GRCm39) missense possibly damaging 0.74
R7383:Vmn2r12 UTSW 5 109,240,684 (GRCm39) missense probably benign 0.19
R7740:Vmn2r12 UTSW 5 109,239,615 (GRCm39) missense probably damaging 1.00
R7861:Vmn2r12 UTSW 5 109,235,829 (GRCm39) missense probably benign 0.00
R7908:Vmn2r12 UTSW 5 109,234,307 (GRCm39) missense probably damaging 1.00
R8128:Vmn2r12 UTSW 5 109,239,747 (GRCm39) missense possibly damaging 0.81
R8175:Vmn2r12 UTSW 5 109,238,349 (GRCm39) missense probably damaging 0.97
R8234:Vmn2r12 UTSW 5 109,234,074 (GRCm39) missense probably benign 0.01
R8771:Vmn2r12 UTSW 5 109,239,952 (GRCm39) missense possibly damaging 0.95
R8947:Vmn2r12 UTSW 5 109,234,522 (GRCm39) missense possibly damaging 0.64
R8991:Vmn2r12 UTSW 5 109,234,033 (GRCm39) nonsense probably null
R9116:Vmn2r12 UTSW 5 109,233,885 (GRCm39) missense probably damaging 1.00
R9122:Vmn2r12 UTSW 5 109,240,910 (GRCm39) missense probably benign 0.00
R9153:Vmn2r12 UTSW 5 109,234,203 (GRCm39) missense probably damaging 1.00
R9371:Vmn2r12 UTSW 5 109,234,452 (GRCm39) missense probably benign 0.00
R9375:Vmn2r12 UTSW 5 109,233,986 (GRCm39) missense probably damaging 1.00
R9524:Vmn2r12 UTSW 5 109,239,823 (GRCm39) missense probably damaging 1.00
R9587:Vmn2r12 UTSW 5 109,239,322 (GRCm39) missense probably damaging 0.99
Z1088:Vmn2r12 UTSW 5 109,240,646 (GRCm39) missense probably benign
Z1176:Vmn2r12 UTSW 5 109,239,303 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGGAGAAAGATGCACCC -3'
(R):5'- GGCACCTAACTTGGTCATTCCC -3'

Sequencing Primer
(F):5'- TGCACCCTAGCAAGCCTG -3'
(R):5'- AATCCAACTTGTCCTCTGTGG -3'
Posted On 2019-11-26