Incidental Mutation 'R7749:Pxn'
ID597087
Institutional Source Beutler Lab
Gene Symbol Pxn
Ensembl Gene ENSMUSG00000029528
Gene Namepaxillin
SynonymsPax
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7749 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location115506676-115555987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115548516 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 356 (Y356N)
Ref Sequence ENSEMBL: ENSMUSP00000148843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067268] [ENSMUST00000086523] [ENSMUST00000137716] [ENSMUST00000157050] [ENSMUST00000202564] [ENSMUST00000212819]
Predicted Effect probably benign
Transcript: ENSMUST00000067268
SMART Domains Protein: ENSMUSP00000069624
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 1.6e-98 PFAM
low complexity region 281 300 N/A INTRINSIC
LIM 323 374 3.99e-23 SMART
LIM 382 433 2.36e-16 SMART
LIM 441 492 8.16e-20 SMART
LIM 500 551 8.62e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086523
SMART Domains Protein: ENSMUSP00000083709
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 4.8e-97 PFAM
low complexity region 315 334 N/A INTRINSIC
LIM 357 408 3.99e-23 SMART
LIM 416 467 2.36e-16 SMART
LIM 475 526 8.16e-20 SMART
LIM 534 585 8.62e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137716
SMART Domains Protein: ENSMUSP00000144513
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 1.9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000157050
SMART Domains Protein: ENSMUSP00000143926
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 106 1.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202564
SMART Domains Protein: ENSMUSP00000144459
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 5.8e-59 PFAM
low complexity region 148 167 N/A INTRINSIC
LIM 190 241 1.9e-25 SMART
LIM 249 300 1.1e-18 SMART
LIM 308 359 4e-22 SMART
LIM 367 418 4.4e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212819
AA Change: Y356N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein involved in actin-membrane attachment at sites of cell adhesion to the extracellular matrix (focal adhesion). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. These isoforms exhibit different expression pattern, and have different biochemical, as well as physiological properties (PMID:9054445). [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice die at E9.5 with defects in the amnion, allantois, and headfold structures, as well as impaired growth, and abnormal heart and somite development; mutant fibroblasts show aberrant fibronectin-regulated focal adhesion dynamics, and disorganized membrane cytoskeletal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A T 1: 134,390,512 M341L probably benign Het
Actr1a A T 19: 46,379,747 S254T probably benign Het
Adam12 G A 7: 134,224,813 A22V unknown Het
Adarb2 A G 13: 8,569,739 D87G possibly damaging Het
Aldh6a1 A T 12: 84,442,081 I59N probably benign Het
Ankrd50 C T 3: 38,482,721 C161Y probably damaging Het
Anks1 T A 17: 28,038,141 I707N probably damaging Het
Atoh1 A T 6: 64,729,920 M200L possibly damaging Het
Bmp1 C T 14: 70,492,844 R416H probably damaging Het
Caprin1 A G 2: 103,771,754 S548P probably benign Het
Ccdc167 T A 17: 29,705,273 Y63F possibly damaging Het
Cfap99 T A 5: 34,307,940 D174E probably benign Het
Chil3 T G 3: 106,148,845 N331T probably benign Het
Chmp5 T A 4: 40,949,488 I35N probably damaging Het
Cpt1c A T 7: 44,962,265 S537T probably benign Het
Dhx57 T A 17: 80,238,858 M1366L probably benign Het
Dnah9 T A 11: 65,911,830 Y3478F probably damaging Het
Efna3 A G 3: 89,316,640 Y81H probably damaging Het
Eif4enif1 T C 11: 3,242,608 V812A probably damaging Het
Erg A T 16: 95,377,357 I237N probably benign Het
Fem1c G T 18: 46,524,118 N176K probably damaging Het
Fgd4 T C 16: 16,475,154 Y233C probably benign Het
Foxd2 G A 4: 114,907,812 A337V unknown Het
Gsdma2 T C 11: 98,657,721 L433P unknown Het
Hnrnpul2 T C 19: 8,820,424 V48A probably benign Het
Hsf1 T A 15: 76,499,187 S396T probably benign Het
Htr5b G T 1: 121,527,758 N144K probably damaging Het
Igkv9-120 T C 6: 68,050,188 S29P probably damaging Het
Igsf10 T A 3: 59,329,128 N1211Y possibly damaging Het
Kcnh1 A C 1: 192,277,139 I334L probably benign Het
Laptm4b T C 15: 34,276,200 I158T probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,703,352 T2063A probably damaging Het
Nckap5 A G 1: 126,024,646 S1390P probably damaging Het
Npepps T G 11: 97,267,628 I104L probably benign Het
Numb A G 12: 83,801,277 S229P not run Het
Olfr1156 G A 2: 87,949,478 H252Y probably damaging Het
Olfr1342 T C 4: 118,690,228 S75G probably damaging Het
Olfr1443 A T 19: 12,680,212 I35F probably benign Het
Opn1sw T A 6: 29,380,169 I83F probably benign Het
Pigg T G 5: 108,336,296 C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 C A 15: 44,527,737 H1504N probably benign Het
Plcd4 A G 1: 74,565,133 N757D possibly damaging Het
Ppia A G 11: 6,419,569 T152A probably benign Het
Rhoa G C 9: 108,336,715 C159S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rita1 C T 5: 120,611,441 C69Y probably benign Het
Satb1 A G 17: 51,767,933 S512P possibly damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Slc22a6 A G 19: 8,621,896 K297R possibly damaging Het
Snrnp48 T C 13: 38,221,287 Y287H probably benign Het
Sntg2 A T 12: 30,226,911 C381S probably benign Het
Syngap1 T A 17: 26,959,964 M649K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thap2 T C 10: 115,376,384 I79V probably damaging Het
Thap7 T C 16: 17,528,603 N172S probably benign Het
Ticrr A G 7: 79,679,096 Y661C possibly damaging Het
Ttn T C 2: 76,776,315 N18084D probably damaging Het
Usp48 A T 4: 137,650,417 K1020M probably damaging Het
Vmn2r12 T C 5: 109,086,054 N764S probably damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Wfdc6b T A 2: 164,617,419 C134S probably damaging Het
Zcchc2 A T 1: 106,018,273 D481V probably damaging Het
Zfp949 G A 9: 88,569,870 G498R probably damaging Het
Other mutations in Pxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Pxn APN 5 115544926 missense probably benign 0.00
IGL02432:Pxn APN 5 115545746 missense probably damaging 1.00
IGL02454:Pxn APN 5 115552266 missense probably damaging 1.00
R0316:Pxn UTSW 5 115553968 missense probably damaging 1.00
R0778:Pxn UTSW 5 115552177 missense probably damaging 1.00
R1680:Pxn UTSW 5 115552147 missense probably damaging 1.00
R1874:Pxn UTSW 5 115544990 missense probably damaging 1.00
R2069:Pxn UTSW 5 115545667 missense probably benign 0.26
R2145:Pxn UTSW 5 115552756 unclassified probably benign
R4124:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4126:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4127:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4551:Pxn UTSW 5 115552720 unclassified probably benign
R4717:Pxn UTSW 5 115551942 missense probably damaging 0.99
R5217:Pxn UTSW 5 115544915 missense probably benign 0.13
R5332:Pxn UTSW 5 115544369 missense probably damaging 1.00
R5635:Pxn UTSW 5 115551492 missense probably benign
R5681:Pxn UTSW 5 115544534 missense possibly damaging 0.94
R6629:Pxn UTSW 5 115554062 missense probably damaging 1.00
R6702:Pxn UTSW 5 115551896 missense probably benign 0.11
R7516:Pxn UTSW 5 115506863 missense unknown
R7671:Pxn UTSW 5 115548547 missense not run
R7866:Pxn UTSW 5 115548606 missense possibly damaging 0.85
R7949:Pxn UTSW 5 115548606 missense possibly damaging 0.85
X0018:Pxn UTSW 5 115545732 missense probably damaging 1.00
X0025:Pxn UTSW 5 115546895 missense probably damaging 0.97
X0065:Pxn UTSW 5 115551487 critical splice acceptor site probably null
Z1177:Pxn UTSW 5 115553893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCTGCTGTGCTGCTGAG -3'
(R):5'- CTGAAAACACATGGTTGGCC -3'

Sequencing Primer
(F):5'- TGTGCTGCTGAGCTCCCAG -3'
(R):5'- TCCTTGCAGGGTATGGA -3'
Posted On2019-11-26