Incidental Mutation 'R7749:Sntg2'
ID597107
Institutional Source Beutler Lab
Gene Symbol Sntg2
Ensembl Gene ENSMUSG00000020672
Gene Namesyntrophin, gamma 2
Synonyms2210008K22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R7749 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location30174482-30373375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30226911 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 381 (C381S)
Ref Sequence ENSEMBL: ENSMUSP00000021004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021004] [ENSMUST00000133324] [ENSMUST00000142046] [ENSMUST00000149710]
Predicted Effect probably benign
Transcript: ENSMUST00000021004
AA Change: C381S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000021004
Gene: ENSMUSG00000020672
AA Change: C381S

DomainStartEndE-ValueType
PDZ 82 156 1.83e-17 SMART
low complexity region 159 183 N/A INTRINSIC
PH 297 423 7.66e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133324
SMART Domains Protein: ENSMUSP00000114245
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
Blast:PH 13 70 9e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142046
SMART Domains Protein: ENSMUSP00000115942
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
Blast:PH 13 89 1e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149710
SMART Domains Protein: ENSMUSP00000123332
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
PDZ 82 156 1.83e-17 SMART
low complexity region 159 183 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that bind to components of mechanosenstive sodium channels and the extreme carboxy-terminal domain of dystrophin and dystrophin-related proteins. The PDZ domain of this protein product interacts with a protein component of a mechanosensitive sodium channel that affects channel gating. Absence or reduction of this protein product has been associated with Duchenne muscular dystrophy. There is evidence of alternative splicing yet the full-length nature of these variants has not been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A T 1: 134,390,512 M341L probably benign Het
Actr1a A T 19: 46,379,747 S254T probably benign Het
Adam12 G A 7: 134,224,813 A22V unknown Het
Adarb2 A G 13: 8,569,739 D87G possibly damaging Het
Aldh6a1 A T 12: 84,442,081 I59N probably benign Het
Ankrd50 C T 3: 38,482,721 C161Y probably damaging Het
Ankrd7 A G 6: 18,879,516 probably null Het
Anks1 T A 17: 28,038,141 I707N probably damaging Het
Atoh1 A T 6: 64,729,920 M200L possibly damaging Het
Bmp1 C T 14: 70,492,844 R416H probably damaging Het
Caprin1 A G 2: 103,771,754 S548P probably benign Het
Ccdc167 T A 17: 29,705,273 Y63F possibly damaging Het
Cfap99 T A 5: 34,307,940 D174E probably benign Het
Chil3 T G 3: 106,148,845 N331T probably benign Het
Chmp5 T A 4: 40,949,488 I35N probably damaging Het
Cpt1c A T 7: 44,962,265 S537T probably benign Het
Dctn1 A T 6: 83,186,141 probably benign Het
Dhx57 T A 17: 80,238,858 M1366L probably benign Het
Dnah9 T A 11: 65,911,830 Y3478F probably damaging Het
Efna3 A G 3: 89,316,640 Y81H probably damaging Het
Eif4enif1 T C 11: 3,242,608 V812A probably damaging Het
Erg A T 16: 95,377,357 I237N probably benign Het
Fem1c G T 18: 46,524,118 N176K probably damaging Het
Fgd4 T C 16: 16,475,154 Y233C probably benign Het
Foxd2 G A 4: 114,907,812 A337V unknown Het
Gsdma2 T C 11: 98,657,721 L433P unknown Het
Hmcn2 C A 2: 31,453,033 probably null Het
Hnrnpul2 T C 19: 8,820,424 V48A probably benign Het
Hsf1 T A 15: 76,499,187 S396T probably benign Het
Htr5b G T 1: 121,527,758 N144K probably damaging Het
Igkv9-120 T C 6: 68,050,188 S29P probably damaging Het
Igsf10 T A 3: 59,329,128 N1211Y possibly damaging Het
Kcnh1 A C 1: 192,277,139 I334L probably benign Het
Laptm4b T C 15: 34,276,200 I158T probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,703,352 T2063A probably damaging Het
Nceh1 T A 3: 27,207,382 D47E probably benign Het
Nckap5 A G 1: 126,024,646 S1390P probably damaging Het
Npepps T G 11: 97,267,628 I104L probably benign Het
Numb A G 12: 83,801,277 S229P not run Het
Olfr1156 G A 2: 87,949,478 H252Y probably damaging Het
Olfr1342 T C 4: 118,690,228 S75G probably damaging Het
Olfr1443 A T 19: 12,680,212 I35F probably benign Het
Opn1sw T A 6: 29,380,169 I83F probably benign Het
Pigg T G 5: 108,336,296 C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 C A 15: 44,527,737 H1504N probably benign Het
Plcd4 A G 1: 74,565,133 N757D possibly damaging Het
Ppia A G 11: 6,419,569 T152A probably benign Het
Psmd8 G A 7: 29,178,921 probably null Het
Pxn T A 5: 115,548,516 Y356N probably benign Het
Rhoa G C 9: 108,336,715 C159S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rita1 C T 5: 120,611,441 C69Y probably benign Het
Satb1 A G 17: 51,767,933 S512P possibly damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Slc22a6 A G 19: 8,621,896 K297R possibly damaging Het
Snrnp48 T C 13: 38,221,287 Y287H probably benign Het
Syngap1 T A 17: 26,959,964 M649K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thap2 T C 10: 115,376,384 I79V probably damaging Het
Thap7 T C 16: 17,528,603 N172S probably benign Het
Ticrr A G 7: 79,679,096 Y661C possibly damaging Het
Ttn T C 2: 76,776,315 N18084D probably damaging Het
Usp48 A T 4: 137,650,417 K1020M probably damaging Het
Vmn2r12 T C 5: 109,086,054 N764S probably damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Wfdc6b T A 2: 164,617,419 C134S probably damaging Het
Zcchc2 A T 1: 106,018,273 D481V probably damaging Het
Zfp949 G A 9: 88,569,870 G498R probably damaging Het
Other mutations in Sntg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sntg2 APN 12 30276721 missense probably benign 0.08
IGL00914:Sntg2 APN 12 30257957 intron probably benign
IGL00950:Sntg2 APN 12 30312681 splice site probably benign
IGL01106:Sntg2 APN 12 30257988 nonsense probably null
IGL01732:Sntg2 APN 12 30312649 missense probably damaging 0.99
IGL01987:Sntg2 APN 12 30312570 missense probably damaging 1.00
IGL02138:Sntg2 APN 12 30307231 critical splice acceptor site probably null
IGL02325:Sntg2 APN 12 30195543 missense probably benign 0.08
IGL02619:Sntg2 APN 12 30267026 splice site probably null
IGL02797:Sntg2 APN 12 30226892 missense possibly damaging 0.93
IGL03176:Sntg2 APN 12 30267023 splice site probably benign
PIT4445001:Sntg2 UTSW 12 30312572 missense probably damaging 1.00
R0126:Sntg2 UTSW 12 30201261 splice site probably benign
R0309:Sntg2 UTSW 12 30226773 missense probably benign 0.03
R0614:Sntg2 UTSW 12 30257978 missense possibly damaging 0.87
R1267:Sntg2 UTSW 12 30245128 missense probably benign 0.42
R1546:Sntg2 UTSW 12 30288296 missense probably damaging 1.00
R1696:Sntg2 UTSW 12 30267063 missense probably damaging 1.00
R1708:Sntg2 UTSW 12 30373180 missense possibly damaging 0.81
R1867:Sntg2 UTSW 12 30236651 missense probably benign
R2256:Sntg2 UTSW 12 30236688 nonsense probably null
R2895:Sntg2 UTSW 12 30226846 missense probably benign 0.00
R3401:Sntg2 UTSW 12 30288172 splice site probably benign
R3522:Sntg2 UTSW 12 30312567 missense probably damaging 0.99
R4771:Sntg2 UTSW 12 30276659 splice site probably null
R4814:Sntg2 UTSW 12 30373268 unclassified probably benign
R5554:Sntg2 UTSW 12 30258041 missense probably benign 0.08
R6056:Sntg2 UTSW 12 30312561 missense probably benign 0.06
R6328:Sntg2 UTSW 12 30258014 missense probably damaging 1.00
R6373:Sntg2 UTSW 12 30258041 missense probably benign 0.08
R7314:Sntg2 UTSW 12 30267108 missense probably benign 0.01
R7494:Sntg2 UTSW 12 30229634 missense possibly damaging 0.89
R7571:Sntg2 UTSW 12 30175202 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCAAGGTGTCAGATATTGCC -3'
(R):5'- TCTACCAGAGCAGTCAAATGC -3'

Sequencing Primer
(F):5'- TTGCCCCAAAGCTGATAGTG -3'
(R):5'- GCAACCCTTTTCTCAAAGAGTGGG -3'
Posted On2019-11-26