Incidental Mutation 'R0632:Art5'
ID 59711
Institutional Source Beutler Lab
Gene Symbol Art5
Ensembl Gene ENSMUSG00000070424
Gene Name ADP-ribosyltransferase 5
Synonyms Yac-2
MMRRC Submission 038821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R0632 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 102096879-102109489 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 102097957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 205 (T205I)
Ref Sequence ENSEMBL: ENSMUSP00000102550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033300] [ENSMUST00000084843] [ENSMUST00000094128] [ENSMUST00000106934] [ENSMUST00000106935] [ENSMUST00000106937] [ENSMUST00000123372] [ENSMUST00000124189] [ENSMUST00000139104] [ENSMUST00000209809] [ENSMUST00000210211]
AlphaFold P70352
Predicted Effect probably benign
Transcript: ENSMUST00000033300
SMART Domains Protein: ENSMUSP00000033300
Gene: ENSMUSG00000030996

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ART 39 269 2e-99 PFAM
low complexity region 288 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084843
SMART Domains Protein: ENSMUSP00000081903
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 150 1.4e-54 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 1e-24 PFAM
Pfam:Ion_trans 716 1024 1.7e-24 PFAM
Pfam:PKD_channel 774 1019 2.4e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094128
AA Change: T205I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091678
Gene: ENSMUSG00000070424
AA Change: T205I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 3.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106934
SMART Domains Protein: ENSMUSP00000102547
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 117 3.7e-29 PFAM
Pfam:ART 114 157 6.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106935
SMART Domains Protein: ENSMUSP00000102548
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 146 2.1e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106937
AA Change: T205I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102550
Gene: ENSMUSG00000070424
AA Change: T205I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 1.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123372
SMART Domains Protein: ENSMUSP00000121068
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000124189
SMART Domains Protein: ENSMUSP00000116934
Gene: ENSMUSG00000100254

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
ANK 65 95 1.58e3 SMART
low complexity region 110 122 N/A INTRINSIC
ANK 148 177 1.74e0 SMART
Pfam:TRP_2 183 245 9.1e-29 PFAM
transmembrane domain 345 367 N/A INTRINSIC
Pfam:PKD_channel 398 645 1.4e-12 PFAM
Pfam:Ion_trans 422 638 1e-31 PFAM
low complexity region 696 707 N/A INTRINSIC
low complexity region 719 730 N/A INTRINSIC
coiled coil region 748 788 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139104
SMART Domains Protein: ENSMUSP00000122430
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155078
SMART Domains Protein: ENSMUSP00000123466
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209809
Predicted Effect probably benign
Transcript: ENSMUST00000210211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211553
Meta Mutation Damage Score 0.9243 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,227,618 D83G probably benign Het
Acaa1a T A 9: 119,347,818 probably benign Het
Adgrg7 T A 16: 56,742,589 T462S possibly damaging Het
Akap6 A T 12: 52,937,148 N825I probably damaging Het
Ankib1 T A 5: 3,772,529 N59I probably benign Het
Anks6 T C 4: 47,033,167 S633G possibly damaging Het
Ap4e1 C A 2: 127,049,280 Y522* probably null Het
Ascc2 T A 11: 4,649,855 L176H probably damaging Het
Atp13a5 T C 16: 29,298,208 D529G probably benign Het
C2cd4a T C 9: 67,831,563 E66G probably benign Het
C8a T C 4: 104,856,492 D147G probably damaging Het
Ccdc109b T C 3: 129,918,726 M167V probably benign Het
Ccdc14 T C 16: 34,721,649 V532A possibly damaging Het
Ccdc88a T A 11: 29,482,749 probably benign Het
Cfap54 C T 10: 92,885,096 E2543K unknown Het
Cldn13 C T 5: 134,914,747 E195K probably benign Het
Cp A G 3: 19,971,082 S402G probably null Het
Cpa3 T C 3: 20,225,194 T194A probably benign Het
Crygf C A 1: 65,927,997 Y93* probably null Het
Ctsh A G 9: 90,061,582 R87G possibly damaging Het
Cyp2t4 A G 7: 27,158,246 D428G possibly damaging Het
Dnah17 C G 11: 118,067,682 probably benign Het
Dnah3 A G 7: 119,967,905 V2366A probably benign Het
Dscaml1 A T 9: 45,732,134 I1284F probably benign Het
Dsg1c T C 18: 20,272,346 probably benign Het
Dst G T 1: 34,271,413 R4098L probably damaging Het
Efhb A G 17: 53,413,459 probably benign Het
Epha7 A T 4: 28,821,104 I90F probably damaging Het
Fam171a2 T A 11: 102,437,881 D684V probably damaging Het
Fan1 A G 7: 64,363,199 V665A possibly damaging Het
Fbn2 A G 18: 58,037,747 C2191R probably damaging Het
Fkbp3 G A 12: 65,073,918 A2V probably benign Het
G6pd2 A G 5: 61,810,171 N430D probably benign Het
Gm13119 G A 4: 144,363,782 C464Y probably damaging Het
Gm13547 T A 2: 29,761,584 D7E possibly damaging Het
Hdac5 A T 11: 102,205,812 D260E probably damaging Het
Hist1h4i G T 13: 22,041,027 Y99* probably null Het
Hsf2bp T C 17: 32,013,346 E142G probably damaging Het
Igf1r C T 7: 68,165,155 T268I probably damaging Het
Kcne3 C T 7: 100,184,439 R88C probably damaging Het
Klk1b9 G T 7: 43,979,372 G100V possibly damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lama1 C T 17: 67,752,368 probably benign Het
Lcp2 C T 11: 34,082,426 P335S possibly damaging Het
Lrrk2 T A 15: 91,796,028 N2047K probably damaging Het
Mia2 T C 12: 59,136,143 L36P probably damaging Het
Mmp13 A T 9: 7,282,077 I460F possibly damaging Het
Mmp13 G A 9: 7,274,032 G169R probably damaging Het
Msh4 A G 3: 153,896,895 I232T probably damaging Het
Msra T A 14: 64,210,532 M145L probably benign Het
Myo7a A T 7: 98,112,150 probably benign Het
Nme8 A T 13: 19,658,036 N422K probably damaging Het
Nol6 A T 4: 41,121,115 F353I probably damaging Het
Nphp3 A G 9: 104,018,274 K384E probably damaging Het
Olfr572 C T 7: 102,928,604 probably null Het
Olfr652 A G 7: 104,564,337 I39V probably benign Het
Olfr672 A G 7: 104,996,703 I67T probably benign Het
Phox2b T G 5: 67,096,214 probably benign Het
Plec A T 15: 76,173,411 S4131T probably damaging Het
Pptc7 G A 5: 122,313,591 probably benign Het
Prpf40b A G 15: 99,316,289 E810G probably benign Het
Ptprc C T 1: 138,073,610 V965I probably benign Het
Pum1 T A 4: 130,728,104 M180K probably benign Het
Ranbp3 T C 17: 56,702,896 probably benign Het
Rasgrf2 A G 13: 91,972,274 S787P probably benign Het
Rnf19b T A 4: 129,073,551 N294K probably damaging Het
Samd3 A T 10: 26,244,495 H156L possibly damaging Het
Serpinb6c C T 13: 33,880,031 R347Q possibly damaging Het
Slc36a3 A G 11: 55,125,080 I416T probably damaging Het
Slc4a4 T A 5: 89,129,641 F279Y probably damaging Het
Slc6a2 T A 8: 92,992,801 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tab2 A G 10: 7,919,801 S232P probably benign Het
Tacc2 A T 7: 130,625,595 K1356* probably null Het
Tmem87a A G 2: 120,359,542 S544P probably damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Usp38 A T 8: 81,014,150 V96E probably benign Het
Vmn2r59 T C 7: 42,058,884 Y33C probably damaging Het
Vsig10l T G 7: 43,464,137 V171G probably damaging Het
Zfp957 T A 14: 79,212,920 I480F probably damaging Het
Other mutations in Art5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Art5 APN 7 102097916 missense probably null
IGL02507:Art5 APN 7 102099492 start codon destroyed probably null 0.83
IGL03143:Art5 APN 7 102097897 missense probably damaging 1.00
Buonarotti UTSW 7 102098170 missense probably damaging 1.00
R1215:Art5 UTSW 7 102097909 missense probably damaging 0.99
R2151:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R2152:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R2153:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R4533:Art5 UTSW 7 102098338 missense probably benign
R4719:Art5 UTSW 7 102098494 splice site probably null
R5042:Art5 UTSW 7 102099465 missense probably damaging 0.99
R5098:Art5 UTSW 7 102097970 missense probably damaging 0.98
R5341:Art5 UTSW 7 102098099 missense probably benign 0.01
R6037:Art5 UTSW 7 102098384 missense probably benign 0.01
R6037:Art5 UTSW 7 102098384 missense probably benign 0.01
R6262:Art5 UTSW 7 102098131 missense probably benign 0.00
R6850:Art5 UTSW 7 102098095 missense possibly damaging 0.60
R7186:Art5 UTSW 7 102097329 missense probably benign
R7270:Art5 UTSW 7 102097873 missense probably damaging 1.00
R7381:Art5 UTSW 7 102098170 missense probably damaging 1.00
R7729:Art5 UTSW 7 102098504 missense possibly damaging 0.51
R8061:Art5 UTSW 7 102098249 missense possibly damaging 0.92
R8112:Art5 UTSW 7 102098011 missense probably benign
R8700:Art5 UTSW 7 102099655 unclassified probably benign
R9043:Art5 UTSW 7 102099492 start codon destroyed probably null 0.98
R9093:Art5 UTSW 7 102098189 missense probably benign 0.00
X0061:Art5 UTSW 7 102098380 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGGTGGAGCCCCAATCTCACTAAC -3'
(R):5'- TCAAGGCCCTGCATTTCTACTTGAC -3'

Sequencing Primer
(F):5'- GGGTCAGAATACACTGGCTTC -3'
(R):5'- TCACTTTGAACCCAAGAGGC -3'
Posted On 2013-07-11