Incidental Mutation 'R7749:Bmp1'
ID 597112
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 045805-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7749 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70730284 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 416 (R416H)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably damaging
Transcript: ENSMUST00000022693
AA Change: R416H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: R416H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1a A T 19: 46,368,186 (GRCm39) S254T probably benign Het
Adam12 G A 7: 133,826,542 (GRCm39) A22V unknown Het
Adarb2 A G 13: 8,619,775 (GRCm39) D87G possibly damaging Het
Aldh6a1 A T 12: 84,488,855 (GRCm39) I59N probably benign Het
Ankrd50 C T 3: 38,536,870 (GRCm39) C161Y probably damaging Het
Ankrd7 A G 6: 18,879,515 (GRCm39) probably null Het
Anks1 T A 17: 28,257,115 (GRCm39) I707N probably damaging Het
Atoh1 A T 6: 64,706,904 (GRCm39) M200L possibly damaging Het
Caprin1 A G 2: 103,602,099 (GRCm39) S548P probably benign Het
Ccdc167 T A 17: 29,924,247 (GRCm39) Y63F possibly damaging Het
Cfap99 T A 5: 34,465,284 (GRCm39) D174E probably benign Het
Chil3 T G 3: 106,056,161 (GRCm39) N331T probably benign Het
Chmp5 T A 4: 40,949,488 (GRCm39) I35N probably damaging Het
Cpt1c A T 7: 44,611,689 (GRCm39) S537T probably benign Het
Dctn1 A T 6: 83,163,123 (GRCm39) probably benign Het
Dhx57 T A 17: 80,546,287 (GRCm39) M1366L probably benign Het
Dnah9 T A 11: 65,802,656 (GRCm39) Y3478F probably damaging Het
Efna3 A G 3: 89,223,947 (GRCm39) Y81H probably damaging Het
Eif4enif1 T C 11: 3,192,608 (GRCm39) V812A probably damaging Het
Erg A T 16: 95,178,216 (GRCm39) I237N probably benign Het
Fem1c G T 18: 46,657,185 (GRCm39) N176K probably damaging Het
Fgd4 T C 16: 16,293,018 (GRCm39) Y233C probably benign Het
Foxd2 G A 4: 114,765,009 (GRCm39) A337V unknown Het
Gsdma2 T C 11: 98,548,547 (GRCm39) L433P unknown Het
Hmcn2 C A 2: 31,343,045 (GRCm39) probably null Het
Hnrnpul2 T C 19: 8,797,788 (GRCm39) V48A probably benign Het
Hsf1 T A 15: 76,383,387 (GRCm39) S396T probably benign Het
Htr5b G T 1: 121,455,487 (GRCm39) N144K probably damaging Het
Igkv9-120 T C 6: 68,027,172 (GRCm39) S29P probably damaging Het
Igsf10 T A 3: 59,236,549 (GRCm39) N1211Y possibly damaging Het
Kcnh1 A C 1: 191,959,447 (GRCm39) I334L probably benign Het
Laptm4b T C 15: 34,276,346 (GRCm39) I158T probably benign Het
Mgat4f A T 1: 134,318,250 (GRCm39) M341L probably benign Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nav3 T C 10: 109,539,213 (GRCm39) T2063A probably damaging Het
Nceh1 T A 3: 27,261,531 (GRCm39) D47E probably benign Het
Nckap5 A G 1: 125,952,383 (GRCm39) S1390P probably damaging Het
Npepps T G 11: 97,158,454 (GRCm39) I104L probably benign Het
Numb A G 12: 83,848,051 (GRCm39) S229P not run Het
Opn1sw T A 6: 29,380,168 (GRCm39) I83F probably benign Het
Or13p4 T C 4: 118,547,425 (GRCm39) S75G probably damaging Het
Or5b95 A T 19: 12,657,576 (GRCm39) I35F probably benign Het
Or5l13 G A 2: 87,779,822 (GRCm39) H252Y probably damaging Het
Pigg T G 5: 108,484,162 (GRCm39) C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pkhd1l1 C A 15: 44,391,133 (GRCm39) H1504N probably benign Het
Plcd4 A G 1: 74,604,292 (GRCm39) N757D possibly damaging Het
Ppia A G 11: 6,369,569 (GRCm39) T152A probably benign Het
Psmd8 G A 7: 28,878,346 (GRCm39) probably null Het
Pxn T A 5: 115,686,575 (GRCm39) Y356N probably benign Het
Rhoa G C 9: 108,213,914 (GRCm39) C159S probably damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rita1 C T 5: 120,749,506 (GRCm39) C69Y probably benign Het
Satb1 A G 17: 52,074,961 (GRCm39) S512P possibly damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Slc22a6 A G 19: 8,599,260 (GRCm39) K297R possibly damaging Het
Snrnp48 T C 13: 38,405,263 (GRCm39) Y287H probably benign Het
Sntg2 A T 12: 30,276,910 (GRCm39) C381S probably benign Het
Syngap1 T A 17: 27,178,938 (GRCm39) M649K probably damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Thap2 T C 10: 115,212,289 (GRCm39) I79V probably damaging Het
Thap7 T C 16: 17,346,467 (GRCm39) N172S probably benign Het
Ticrr A G 7: 79,328,844 (GRCm39) Y661C possibly damaging Het
Ttn T C 2: 76,606,659 (GRCm39) N18084D probably damaging Het
Usp48 A T 4: 137,377,728 (GRCm39) K1020M probably damaging Het
Vmn2r12 T C 5: 109,233,920 (GRCm39) N764S probably damaging Het
Vmn2r91 A G 17: 18,356,540 (GRCm39) I736V possibly damaging Het
Wfdc6b T A 2: 164,459,339 (GRCm39) C134S probably damaging Het
Zcchc2 A T 1: 105,946,003 (GRCm39) D481V probably damaging Het
Zfp949 G A 9: 88,451,923 (GRCm39) G498R probably damaging Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTGCCCATGAGTAAGG -3'
(R):5'- GTAAAACACACATGTCCTTCAGCTC -3'

Sequencing Primer
(F):5'- ATGAGTAAGGGCCCCTTCC -3'
(R):5'- CCTGCCCTGTCTCTTAAAGGG -3'
Posted On 2019-11-26