Incidental Mutation 'R7749:Laptm4b'
ID597114
Institutional Source Beutler Lab
Gene Symbol Laptm4b
Ensembl Gene ENSMUSG00000022257
Gene Namelysosomal-associated protein transmembrane 4B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7749 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location34238028-34284302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34276200 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 158 (I158T)
Ref Sequence ENSEMBL: ENSMUSP00000022867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022867] [ENSMUST00000226437] [ENSMUST00000226627]
Predicted Effect probably benign
Transcript: ENSMUST00000022867
AA Change: I158T

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022867
Gene: ENSMUSG00000022257
AA Change: I158T

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Mtp 139 226 6.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226437
Predicted Effect probably benign
Transcript: ENSMUST00000226627
Predicted Effect probably benign
Transcript: ENSMUST00000228547
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A T 1: 134,390,512 M341L probably benign Het
Actr1a A T 19: 46,379,747 S254T probably benign Het
Adam12 G A 7: 134,224,813 A22V unknown Het
Adarb2 A G 13: 8,569,739 D87G possibly damaging Het
Aldh6a1 A T 12: 84,442,081 I59N probably benign Het
Ankrd50 C T 3: 38,482,721 C161Y probably damaging Het
Anks1 T A 17: 28,038,141 I707N probably damaging Het
Atoh1 A T 6: 64,729,920 M200L possibly damaging Het
Bmp1 C T 14: 70,492,844 R416H probably damaging Het
Caprin1 A G 2: 103,771,754 S548P probably benign Het
Ccdc167 T A 17: 29,705,273 Y63F possibly damaging Het
Cfap99 T A 5: 34,307,940 D174E probably benign Het
Chil3 T G 3: 106,148,845 N331T probably benign Het
Chmp5 T A 4: 40,949,488 I35N probably damaging Het
Cpt1c A T 7: 44,962,265 S537T probably benign Het
Dhx57 T A 17: 80,238,858 M1366L probably benign Het
Dnah9 T A 11: 65,911,830 Y3478F probably damaging Het
Efna3 A G 3: 89,316,640 Y81H probably damaging Het
Eif4enif1 T C 11: 3,242,608 V812A probably damaging Het
Erg A T 16: 95,377,357 I237N probably benign Het
Fem1c G T 18: 46,524,118 N176K probably damaging Het
Fgd4 T C 16: 16,475,154 Y233C probably benign Het
Foxd2 G A 4: 114,907,812 A337V unknown Het
Gsdma2 T C 11: 98,657,721 L433P unknown Het
Hnrnpul2 T C 19: 8,820,424 V48A probably benign Het
Hsf1 T A 15: 76,499,187 S396T probably benign Het
Htr5b G T 1: 121,527,758 N144K probably damaging Het
Igkv9-120 T C 6: 68,050,188 S29P probably damaging Het
Igsf10 T A 3: 59,329,128 N1211Y possibly damaging Het
Kcnh1 A C 1: 192,277,139 I334L probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,703,352 T2063A probably damaging Het
Nckap5 A G 1: 126,024,646 S1390P probably damaging Het
Npepps T G 11: 97,267,628 I104L probably benign Het
Numb A G 12: 83,801,277 S229P not run Het
Olfr1156 G A 2: 87,949,478 H252Y probably damaging Het
Olfr1342 T C 4: 118,690,228 S75G probably damaging Het
Olfr1443 A T 19: 12,680,212 I35F probably benign Het
Opn1sw T A 6: 29,380,169 I83F probably benign Het
Pigg T G 5: 108,336,296 C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 C A 15: 44,527,737 H1504N probably benign Het
Plcd4 A G 1: 74,565,133 N757D possibly damaging Het
Ppia A G 11: 6,419,569 T152A probably benign Het
Pxn T A 5: 115,548,516 Y356N probably benign Het
Rhoa G C 9: 108,336,715 C159S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rita1 C T 5: 120,611,441 C69Y probably benign Het
Satb1 A G 17: 51,767,933 S512P possibly damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Slc22a6 A G 19: 8,621,896 K297R possibly damaging Het
Snrnp48 T C 13: 38,221,287 Y287H probably benign Het
Sntg2 A T 12: 30,226,911 C381S probably benign Het
Syngap1 T A 17: 26,959,964 M649K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thap2 T C 10: 115,376,384 I79V probably damaging Het
Thap7 T C 16: 17,528,603 N172S probably benign Het
Ticrr A G 7: 79,679,096 Y661C possibly damaging Het
Ttn T C 2: 76,776,315 N18084D probably damaging Het
Usp48 A T 4: 137,650,417 K1020M probably damaging Het
Vmn2r12 T C 5: 109,086,054 N764S probably damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Wfdc6b T A 2: 164,617,419 C134S probably damaging Het
Zcchc2 A T 1: 106,018,273 D481V probably damaging Het
Zfp949 G A 9: 88,569,870 G498R probably damaging Het
Other mutations in Laptm4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Laptm4b APN 15 34258742 missense probably benign 0.01
IGL02638:Laptm4b APN 15 34277484 missense probably benign 0.06
R0609:Laptm4b UTSW 15 34258689 missense probably damaging 1.00
R2140:Laptm4b UTSW 15 34238332 missense probably benign 0.10
R2142:Laptm4b UTSW 15 34238332 missense probably benign 0.10
R5907:Laptm4b UTSW 15 34258684 missense possibly damaging 0.59
R6275:Laptm4b UTSW 15 34283327 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACAGTGTTGGCTTTCCCTAAC -3'
(R):5'- TGGAAGGCAGGTTAGTATTTCTCTC -3'

Sequencing Primer
(F):5'- GCTGTCTCATCAATAGAGGCATCTG -3'
(R):5'- AGGTTAGTATTTCTCTCTCACACAG -3'
Posted On2019-11-26