Incidental Mutation 'R7749:Hsf1'
ID597116
Institutional Source Beutler Lab
Gene Symbol Hsf1
Ensembl Gene ENSMUSG00000022556
Gene Nameheat shock factor 1
Synonymsheat shock transcription factor 1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7749 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76477422-76501913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76499187 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 396 (S396T)
Ref Sequence ENSEMBL: ENSMUSP00000154638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023214] [ENSMUST00000072838] [ENSMUST00000226860] [ENSMUST00000226872] [ENSMUST00000227478] [ENSMUST00000228371] [ENSMUST00000228757] [ENSMUST00000228868] [ENSMUST00000229363]
Predicted Effect probably benign
Transcript: ENSMUST00000023214
SMART Domains Protein: ENSMUSP00000023214
Gene: ENSMUSG00000022555

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
low complexity region 41 57 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
Pfam:MBOAT 162 485 8.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072838
SMART Domains Protein: ENSMUSP00000072617
Gene: ENSMUSG00000022556

DomainStartEndE-ValueType
HSF 14 118 2.27e-66 SMART
Pfam:Vert_HS_TF 247 414 6e-65 PFAM
Pfam:Vert_HS_TF 412 503 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226238
Predicted Effect probably benign
Transcript: ENSMUST00000226860
Predicted Effect probably benign
Transcript: ENSMUST00000226872
AA Change: S396T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000227478
Predicted Effect probably benign
Transcript: ENSMUST00000228371
AA Change: S396T

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000228688
Predicted Effect probably benign
Transcript: ENSMUST00000228757
Predicted Effect probably benign
Transcript: ENSMUST00000228868
Predicted Effect probably benign
Transcript: ENSMUST00000229363
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a transcription factor that is rapidly induced after temperature stress and binds heat shock promoter elements (HSE). This protein plays a role in the regulation of lifespan. Expression of this gene is repressed by phsphorylation, which promotes binding by heat shock protein 90. [provided by RefSeq, Aug 2016]
PHENOTYPE: Inactivation of this gene results in female infertility. Additional abnormalities observed in one line of targeted mice include placental defects, growth retardation, loss of the classical heat shock response, and impaired immune response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A T 1: 134,390,512 M341L probably benign Het
Actr1a A T 19: 46,379,747 S254T probably benign Het
Adam12 G A 7: 134,224,813 A22V unknown Het
Adarb2 A G 13: 8,569,739 D87G possibly damaging Het
Aldh6a1 A T 12: 84,442,081 I59N probably benign Het
Ankrd50 C T 3: 38,482,721 C161Y probably damaging Het
Anks1 T A 17: 28,038,141 I707N probably damaging Het
Atoh1 A T 6: 64,729,920 M200L possibly damaging Het
Bmp1 C T 14: 70,492,844 R416H probably damaging Het
Caprin1 A G 2: 103,771,754 S548P probably benign Het
Ccdc167 T A 17: 29,705,273 Y63F possibly damaging Het
Cfap99 T A 5: 34,307,940 D174E probably benign Het
Chil3 T G 3: 106,148,845 N331T probably benign Het
Chmp5 T A 4: 40,949,488 I35N probably damaging Het
Cpt1c A T 7: 44,962,265 S537T probably benign Het
Dhx57 T A 17: 80,238,858 M1366L probably benign Het
Dnah9 T A 11: 65,911,830 Y3478F probably damaging Het
Efna3 A G 3: 89,316,640 Y81H probably damaging Het
Eif4enif1 T C 11: 3,242,608 V812A probably damaging Het
Erg A T 16: 95,377,357 I237N probably benign Het
Fem1c G T 18: 46,524,118 N176K probably damaging Het
Fgd4 T C 16: 16,475,154 Y233C probably benign Het
Foxd2 G A 4: 114,907,812 A337V unknown Het
Gsdma2 T C 11: 98,657,721 L433P unknown Het
Hnrnpul2 T C 19: 8,820,424 V48A probably benign Het
Htr5b G T 1: 121,527,758 N144K probably damaging Het
Igkv9-120 T C 6: 68,050,188 S29P probably damaging Het
Igsf10 T A 3: 59,329,128 N1211Y possibly damaging Het
Kcnh1 A C 1: 192,277,139 I334L probably benign Het
Laptm4b T C 15: 34,276,200 I158T probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,703,352 T2063A probably damaging Het
Nckap5 A G 1: 126,024,646 S1390P probably damaging Het
Npepps T G 11: 97,267,628 I104L probably benign Het
Numb A G 12: 83,801,277 S229P not run Het
Olfr1156 G A 2: 87,949,478 H252Y probably damaging Het
Olfr1342 T C 4: 118,690,228 S75G probably damaging Het
Olfr1443 A T 19: 12,680,212 I35F probably benign Het
Opn1sw T A 6: 29,380,169 I83F probably benign Het
Pigg T G 5: 108,336,296 C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 C A 15: 44,527,737 H1504N probably benign Het
Plcd4 A G 1: 74,565,133 N757D possibly damaging Het
Ppia A G 11: 6,419,569 T152A probably benign Het
Pxn T A 5: 115,548,516 Y356N probably benign Het
Rhoa G C 9: 108,336,715 C159S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rita1 C T 5: 120,611,441 C69Y probably benign Het
Satb1 A G 17: 51,767,933 S512P possibly damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Slc22a6 A G 19: 8,621,896 K297R possibly damaging Het
Snrnp48 T C 13: 38,221,287 Y287H probably benign Het
Sntg2 A T 12: 30,226,911 C381S probably benign Het
Syngap1 T A 17: 26,959,964 M649K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thap2 T C 10: 115,376,384 I79V probably damaging Het
Thap7 T C 16: 17,528,603 N172S probably benign Het
Ticrr A G 7: 79,679,096 Y661C possibly damaging Het
Ttn T C 2: 76,776,315 N18084D probably damaging Het
Usp48 A T 4: 137,650,417 K1020M probably damaging Het
Vmn2r12 T C 5: 109,086,054 N764S probably damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Wfdc6b T A 2: 164,617,419 C134S probably damaging Het
Zcchc2 A T 1: 106,018,273 D481V probably damaging Het
Zfp949 G A 9: 88,569,870 G498R probably damaging Het
Other mutations in Hsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Hsf1 APN 15 76498203 missense probably benign 0.01
IGL01668:Hsf1 APN 15 76496962 critical splice donor site probably null
IGL01724:Hsf1 APN 15 76496837 missense possibly damaging 0.83
IGL02111:Hsf1 APN 15 76496081 splice site probably benign
IGL02503:Hsf1 APN 15 76498670 missense probably benign 0.03
IGL03137:Hsf1 APN 15 76496449 splice site probably benign
R0350:Hsf1 UTSW 15 76500479 missense probably benign 0.00
R6906:Hsf1 UTSW 15 76477719 critical splice donor site probably null
R7170:Hsf1 UTSW 15 76500021 missense probably damaging 1.00
R8050:Hsf1 UTSW 15 76498281 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCTCCCTAGTCCTGACACAG -3'
(R):5'- CATTGGCTTGTGCAAAGGGTAG -3'

Sequencing Primer
(F):5'- ATGAGCCAAGGCCCAGC -3'
(R):5'- CTTGTGCAAAGGGTAGTCAGTG -3'
Posted On2019-11-26