Incidental Mutation 'R7749:Erg'
ID597119
Institutional Source Beutler Lab
Gene Symbol Erg
Ensembl Gene ENSMUSG00000040732
Gene NameETS transcription factor
SynonymsD030036I24Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7749 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location95360204-95530365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95377357 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 237 (I237N)
Ref Sequence ENSEMBL: ENSMUSP00000109479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113848] [ENSMUST00000121809] [ENSMUST00000122199] [ENSMUST00000171646] [ENSMUST00000176345]
Predicted Effect probably benign
Transcript: ENSMUST00000113848
AA Change: I237N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109479
Gene: ENSMUSG00000040732
AA Change: I237N

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 294 379 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121809
SMART Domains Protein: ENSMUSP00000113723
Gene: ENSMUSG00000040732

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 286 371 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122199
AA Change: I230N

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114072
Gene: ENSMUSG00000040732
AA Change: I230N

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 310 395 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171646
SMART Domains Protein: ENSMUSP00000132766
Gene: ENSMUSG00000040732

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 270 355 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176345
AA Change: I230N

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135568
Gene: ENSMUSG00000040732
AA Change: I230N

DomainStartEndE-ValueType
SAM_PNT 23 107 6.99e-32 SMART
ETS 218 303 9.9e-58 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the erythroblast transformation-specific (ETS) family of transcriptions factors. All members of this family are key regulators of embryonic development, cell proliferation, differentiation, angiogenesis, inflammation, and apoptosis. The protein encoded by this gene is mainly expressed in the nucleus. It contains an ETS DNA-binding domain and a PNT (pointed) domain which is implicated in the self-association of chimeric oncoproteins. This protein is required for platelet adhesion to the subendothelium, inducing vascular cell remodeling. It also regulates hematopoesis, and the differentiation and maturation of megakaryocytic cells. This gene is involved in chromosomal translocations, resulting in different fusion gene products, such as TMPSSR2-ERG and NDRG1-ERG in prostate cancer, EWS-ERG in Ewing's sarcoma and FUS-ERG in acute myeloid leukemia. More than two dozens of transcript variants generated from combinatorial usage of three alternative promoters and multiple alternative splicing events have been reported, but the full-length nature of many of these variants has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an ENU-induced mutation or a knock-out of isoforms 5 - 7 die during organogenesis and exhibit embryonic growth retardation. Mice homozygous for a knock-out of isoforms 1 - 4 are viable and fertile with no overt abnnormalities. Homozygous knock-out mice develop pulmonary venoocclusive disease, with pancytopenia, pulmonary hemorrhage and hypertension, and heart right ventricle hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A T 1: 134,390,512 M341L probably benign Het
Actr1a A T 19: 46,379,747 S254T probably benign Het
Adam12 G A 7: 134,224,813 A22V unknown Het
Adarb2 A G 13: 8,569,739 D87G possibly damaging Het
Aldh6a1 A T 12: 84,442,081 I59N probably benign Het
Ankrd50 C T 3: 38,482,721 C161Y probably damaging Het
Anks1 T A 17: 28,038,141 I707N probably damaging Het
Atoh1 A T 6: 64,729,920 M200L possibly damaging Het
Bmp1 C T 14: 70,492,844 R416H probably damaging Het
Caprin1 A G 2: 103,771,754 S548P probably benign Het
Ccdc167 T A 17: 29,705,273 Y63F possibly damaging Het
Cfap99 T A 5: 34,307,940 D174E probably benign Het
Chil3 T G 3: 106,148,845 N331T probably benign Het
Chmp5 T A 4: 40,949,488 I35N probably damaging Het
Cpt1c A T 7: 44,962,265 S537T probably benign Het
Dhx57 T A 17: 80,238,858 M1366L probably benign Het
Dnah9 T A 11: 65,911,830 Y3478F probably damaging Het
Efna3 A G 3: 89,316,640 Y81H probably damaging Het
Eif4enif1 T C 11: 3,242,608 V812A probably damaging Het
Fem1c G T 18: 46,524,118 N176K probably damaging Het
Fgd4 T C 16: 16,475,154 Y233C probably benign Het
Foxd2 G A 4: 114,907,812 A337V unknown Het
Gsdma2 T C 11: 98,657,721 L433P unknown Het
Hnrnpul2 T C 19: 8,820,424 V48A probably benign Het
Hsf1 T A 15: 76,499,187 S396T probably benign Het
Htr5b G T 1: 121,527,758 N144K probably damaging Het
Igkv9-120 T C 6: 68,050,188 S29P probably damaging Het
Igsf10 T A 3: 59,329,128 N1211Y possibly damaging Het
Kcnh1 A C 1: 192,277,139 I334L probably benign Het
Laptm4b T C 15: 34,276,200 I158T probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,703,352 T2063A probably damaging Het
Nckap5 A G 1: 126,024,646 S1390P probably damaging Het
Npepps T G 11: 97,267,628 I104L probably benign Het
Numb A G 12: 83,801,277 S229P not run Het
Olfr1156 G A 2: 87,949,478 H252Y probably damaging Het
Olfr1342 T C 4: 118,690,228 S75G probably damaging Het
Olfr1443 A T 19: 12,680,212 I35F probably benign Het
Opn1sw T A 6: 29,380,169 I83F probably benign Het
Pigg T G 5: 108,336,296 C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 C A 15: 44,527,737 H1504N probably benign Het
Plcd4 A G 1: 74,565,133 N757D possibly damaging Het
Ppia A G 11: 6,419,569 T152A probably benign Het
Pxn T A 5: 115,548,516 Y356N probably benign Het
Rhoa G C 9: 108,336,715 C159S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rita1 C T 5: 120,611,441 C69Y probably benign Het
Satb1 A G 17: 51,767,933 S512P possibly damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Slc22a6 A G 19: 8,621,896 K297R possibly damaging Het
Snrnp48 T C 13: 38,221,287 Y287H probably benign Het
Sntg2 A T 12: 30,226,911 C381S probably benign Het
Syngap1 T A 17: 26,959,964 M649K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thap2 T C 10: 115,376,384 I79V probably damaging Het
Thap7 T C 16: 17,528,603 N172S probably benign Het
Ticrr A G 7: 79,679,096 Y661C possibly damaging Het
Ttn T C 2: 76,776,315 N18084D probably damaging Het
Usp48 A T 4: 137,650,417 K1020M probably damaging Het
Vmn2r12 T C 5: 109,086,054 N764S probably damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Wfdc6b T A 2: 164,617,419 C134S probably damaging Het
Zcchc2 A T 1: 106,018,273 D481V probably damaging Het
Zfp949 G A 9: 88,569,870 G498R probably damaging Het
Other mutations in Erg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Erg APN 16 95369989 splice site probably benign
IGL01096:Erg APN 16 95390053 splice site probably benign
IGL01446:Erg APN 16 95361282 missense probably damaging 1.00
IGL01459:Erg APN 16 95361282 missense probably damaging 1.00
IGL01984:Erg APN 16 95409927 missense probably damaging 1.00
IGL03164:Erg APN 16 95409871 missense possibly damaging 0.94
PIT4515001:Erg UTSW 16 95409760 missense probably benign 0.09
R0499:Erg UTSW 16 95360983 nonsense probably null
R0734:Erg UTSW 16 95370025 missense possibly damaging 0.61
R1880:Erg UTSW 16 95377309 missense probably benign 0.07
R2069:Erg UTSW 16 95361078 missense probably damaging 1.00
R4710:Erg UTSW 16 95390034 missense possibly damaging 0.92
R4749:Erg UTSW 16 95361170 missense probably damaging 1.00
R5053:Erg UTSW 16 95524534 missense probably benign 0.00
R5284:Erg UTSW 16 95459243 start codon destroyed probably null 0.01
R5694:Erg UTSW 16 95361031 missense probably benign 0.00
R6212:Erg UTSW 16 95379163 missense probably damaging 0.98
R6258:Erg UTSW 16 95380241 missense probably damaging 0.99
R6260:Erg UTSW 16 95380241 missense probably damaging 0.99
R6856:Erg UTSW 16 95368651 critical splice donor site probably null
R7426:Erg UTSW 16 95459156 intron probably null
R7549:Erg UTSW 16 95369320 critical splice donor site probably null
Z1176:Erg UTSW 16 95361317 missense probably damaging 0.99
Z1176:Erg UTSW 16 95409750 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TACAGCATCTCTGAATCTCAACTG -3'
(R):5'- AGATGCACTCCTGTCTGAGC -3'

Sequencing Primer
(F):5'- AGACTGGCTATATGCACTGC -3'
(R):5'- CAGAGCTCCTGTTTGCCATGAG -3'
Posted On2019-11-26