Incidental Mutation 'R0632:Olfr652'
ID59712
Institutional Source Beutler Lab
Gene Symbol Olfr652
Ensembl Gene ENSMUSG00000073927
Gene Nameolfactory receptor 652
SynonymsMOR31-8, GA_x6K02T2PBJ9-7191524-7192471
MMRRC Submission 038821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0632 (G1)
Quality Score163
Status Validated
Chromosome7
Chromosomal Location104560901-104568634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104564337 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 39 (I39V)
Ref Sequence ENSEMBL: ENSMUSP00000152027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098175] [ENSMUST00000215410] [ENSMUST00000216131] [ENSMUST00000219111]
AlphaFold B9EHE6
Predicted Effect probably benign
Transcript: ENSMUST00000098175
AA Change: I39V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095777
Gene: ENSMUSG00000073927
AA Change: I39V

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:7tm_4 36 315 2.6e-105 PFAM
Pfam:7TM_GPCR_Srsx 40 312 6.9e-9 PFAM
Pfam:7tm_1 46 297 4.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215410
AA Change: I39V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000216131
AA Change: I39V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000219111
AA Change: I39V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.1483 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,227,618 D83G probably benign Het
Acaa1a T A 9: 119,347,818 probably benign Het
Adgrg7 T A 16: 56,742,589 T462S possibly damaging Het
Akap6 A T 12: 52,937,148 N825I probably damaging Het
Ankib1 T A 5: 3,772,529 N59I probably benign Het
Anks6 T C 4: 47,033,167 S633G possibly damaging Het
Ap4e1 C A 2: 127,049,280 Y522* probably null Het
Art5 G A 7: 102,097,957 T205I probably damaging Het
Ascc2 T A 11: 4,649,855 L176H probably damaging Het
Atp13a5 T C 16: 29,298,208 D529G probably benign Het
C2cd4a T C 9: 67,831,563 E66G probably benign Het
C8a T C 4: 104,856,492 D147G probably damaging Het
Ccdc109b T C 3: 129,918,726 M167V probably benign Het
Ccdc14 T C 16: 34,721,649 V532A possibly damaging Het
Ccdc88a T A 11: 29,482,749 probably benign Het
Cfap54 C T 10: 92,885,096 E2543K unknown Het
Cldn13 C T 5: 134,914,747 E195K probably benign Het
Cp A G 3: 19,971,082 S402G probably null Het
Cpa3 T C 3: 20,225,194 T194A probably benign Het
Crygf C A 1: 65,927,997 Y93* probably null Het
Ctsh A G 9: 90,061,582 R87G possibly damaging Het
Cyp2t4 A G 7: 27,158,246 D428G possibly damaging Het
Dnah17 C G 11: 118,067,682 probably benign Het
Dnah3 A G 7: 119,967,905 V2366A probably benign Het
Dscaml1 A T 9: 45,732,134 I1284F probably benign Het
Dsg1c T C 18: 20,272,346 probably benign Het
Dst G T 1: 34,271,413 R4098L probably damaging Het
Efhb A G 17: 53,413,459 probably benign Het
Epha7 A T 4: 28,821,104 I90F probably damaging Het
Fam171a2 T A 11: 102,437,881 D684V probably damaging Het
Fan1 A G 7: 64,363,199 V665A possibly damaging Het
Fbn2 A G 18: 58,037,747 C2191R probably damaging Het
Fkbp3 G A 12: 65,073,918 A2V probably benign Het
G6pd2 A G 5: 61,810,171 N430D probably benign Het
Gm13119 G A 4: 144,363,782 C464Y probably damaging Het
Gm13547 T A 2: 29,761,584 D7E possibly damaging Het
Hdac5 A T 11: 102,205,812 D260E probably damaging Het
Hist1h4i G T 13: 22,041,027 Y99* probably null Het
Hsf2bp T C 17: 32,013,346 E142G probably damaging Het
Igf1r C T 7: 68,165,155 T268I probably damaging Het
Kcne3 C T 7: 100,184,439 R88C probably damaging Het
Klk1b9 G T 7: 43,979,372 G100V possibly damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lama1 C T 17: 67,752,368 probably benign Het
Lcp2 C T 11: 34,082,426 P335S possibly damaging Het
Lrrk2 T A 15: 91,796,028 N2047K probably damaging Het
Mia2 T C 12: 59,136,143 L36P probably damaging Het
Mmp13 G A 9: 7,274,032 G169R probably damaging Het
Mmp13 A T 9: 7,282,077 I460F possibly damaging Het
Msh4 A G 3: 153,896,895 I232T probably damaging Het
Msra T A 14: 64,210,532 M145L probably benign Het
Myo7a A T 7: 98,112,150 probably benign Het
Nme8 A T 13: 19,658,036 N422K probably damaging Het
Nol6 A T 4: 41,121,115 F353I probably damaging Het
Nphp3 A G 9: 104,018,274 K384E probably damaging Het
Olfr572 C T 7: 102,928,604 probably null Het
Olfr672 A G 7: 104,996,703 I67T probably benign Het
Phox2b T G 5: 67,096,214 probably benign Het
Plec A T 15: 76,173,411 S4131T probably damaging Het
Pptc7 G A 5: 122,313,591 probably benign Het
Prpf40b A G 15: 99,316,289 E810G probably benign Het
Ptprc C T 1: 138,073,610 V965I probably benign Het
Pum1 T A 4: 130,728,104 M180K probably benign Het
Ranbp3 T C 17: 56,702,896 probably benign Het
Rasgrf2 A G 13: 91,972,274 S787P probably benign Het
Rnf19b T A 4: 129,073,551 N294K probably damaging Het
Samd3 A T 10: 26,244,495 H156L possibly damaging Het
Serpinb6c C T 13: 33,880,031 R347Q possibly damaging Het
Slc36a3 A G 11: 55,125,080 I416T probably damaging Het
Slc4a4 T A 5: 89,129,641 F279Y probably damaging Het
Slc6a2 T A 8: 92,992,801 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tab2 A G 10: 7,919,801 S232P probably benign Het
Tacc2 A T 7: 130,625,595 K1356* probably null Het
Tmem87a A G 2: 120,359,542 S544P probably damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Usp38 A T 8: 81,014,150 V96E probably benign Het
Vmn2r59 T C 7: 42,058,884 Y33C probably damaging Het
Vsig10l T G 7: 43,464,137 V171G probably damaging Het
Zfp957 T A 14: 79,212,920 I480F probably damaging Het
Other mutations in Olfr652
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr652 APN 7 104564829 missense probably damaging 1.00
IGL01620:Olfr652 APN 7 104565013 missense probably damaging 0.97
IGL01712:Olfr652 APN 7 104565019 missense probably benign
IGL02211:Olfr652 APN 7 104565126 nonsense probably null
IGL03328:Olfr652 APN 7 104564470 missense probably damaging 1.00
K7894:Olfr652 UTSW 7 104564532 missense probably benign 0.12
R0138:Olfr652 UTSW 7 104565003 missense probably benign
R1457:Olfr652 UTSW 7 104565071 missense probably damaging 1.00
R1494:Olfr652 UTSW 7 104564831 nonsense probably null
R1879:Olfr652 UTSW 7 104564911 missense possibly damaging 0.93
R2188:Olfr652 UTSW 7 104564676 missense probably benign 0.00
R2323:Olfr652 UTSW 7 104564619 missense probably benign 0.01
R3862:Olfr652 UTSW 7 104564938 missense probably benign 0.01
R3908:Olfr652 UTSW 7 104564641 missense probably benign 0.01
R4942:Olfr652 UTSW 7 104565005 missense probably benign 0.00
R5443:Olfr652 UTSW 7 104564376 missense probably benign 0.14
R5572:Olfr652 UTSW 7 104564994 missense probably benign 0.08
R6045:Olfr652 UTSW 7 104564767 missense probably benign 0.42
R6973:Olfr652 UTSW 7 104564976 missense probably benign 0.42
R7147:Olfr652 UTSW 7 104564066 start gained probably benign
R7349:Olfr652 UTSW 7 104564650 missense probably benign
R7968:Olfr652 UTSW 7 104564650 missense probably benign 0.01
R8031:Olfr652 UTSW 7 104565109 missense probably damaging 0.99
R8129:Olfr652 UTSW 7 104564377 missense probably benign 0.07
R8198:Olfr652 UTSW 7 104564933 missense probably benign 0.01
R8296:Olfr652 UTSW 7 104564386 missense probably benign
R8345:Olfr652 UTSW 7 104564224 start codon destroyed probably null 0.08
R8475:Olfr652 UTSW 7 104564859 missense probably benign
R8875:Olfr652 UTSW 7 104564463 missense probably benign 0.00
R8881:Olfr652 UTSW 7 104564412 missense possibly damaging 0.58
R8927:Olfr652 UTSW 7 104565022 missense probably damaging 1.00
R8928:Olfr652 UTSW 7 104565022 missense probably damaging 1.00
X0024:Olfr652 UTSW 7 104564250 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTGGACCACTGTAACTATCATGCC -3'
(R):5'- GCTCCTGCTGATAATTGCCACCAC -3'

Sequencing Primer
(F):5'- GACCACTGTAACTATCATGCCATTTC -3'
(R):5'- CATCCAGGAAATGTGATATGCTG -3'
Posted On2013-07-11