Incidental Mutation 'R7749:Vmn2r91'
ID 597120
Institutional Source Beutler Lab
Gene Symbol Vmn2r91
Ensembl Gene ENSMUSG00000091206
Gene Name vomeronasal 2, receptor 91
Synonyms EG665210
MMRRC Submission 045805-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R7749 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 18305319-18356905 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18356540 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 736 (I736V)
Ref Sequence ENSEMBL: ENSMUSP00000127465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172359]
AlphaFold E9Q2U5
Predicted Effect possibly damaging
Transcript: ENSMUST00000172359
AA Change: I736V

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127465
Gene: ENSMUSG00000091206
AA Change: I736V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 462 2.2e-38 PFAM
Pfam:NCD3G 510 564 6.7e-20 PFAM
Pfam:7tm_3 597 832 2.1e-53 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1a A T 19: 46,368,186 (GRCm39) S254T probably benign Het
Adam12 G A 7: 133,826,542 (GRCm39) A22V unknown Het
Adarb2 A G 13: 8,619,775 (GRCm39) D87G possibly damaging Het
Aldh6a1 A T 12: 84,488,855 (GRCm39) I59N probably benign Het
Ankrd50 C T 3: 38,536,870 (GRCm39) C161Y probably damaging Het
Ankrd7 A G 6: 18,879,515 (GRCm39) probably null Het
Anks1 T A 17: 28,257,115 (GRCm39) I707N probably damaging Het
Atoh1 A T 6: 64,706,904 (GRCm39) M200L possibly damaging Het
Bmp1 C T 14: 70,730,284 (GRCm39) R416H probably damaging Het
Caprin1 A G 2: 103,602,099 (GRCm39) S548P probably benign Het
Ccdc167 T A 17: 29,924,247 (GRCm39) Y63F possibly damaging Het
Cfap99 T A 5: 34,465,284 (GRCm39) D174E probably benign Het
Chil3 T G 3: 106,056,161 (GRCm39) N331T probably benign Het
Chmp5 T A 4: 40,949,488 (GRCm39) I35N probably damaging Het
Cpt1c A T 7: 44,611,689 (GRCm39) S537T probably benign Het
Dctn1 A T 6: 83,163,123 (GRCm39) probably benign Het
Dhx57 T A 17: 80,546,287 (GRCm39) M1366L probably benign Het
Dnah9 T A 11: 65,802,656 (GRCm39) Y3478F probably damaging Het
Efna3 A G 3: 89,223,947 (GRCm39) Y81H probably damaging Het
Eif4enif1 T C 11: 3,192,608 (GRCm39) V812A probably damaging Het
Erg A T 16: 95,178,216 (GRCm39) I237N probably benign Het
Fem1c G T 18: 46,657,185 (GRCm39) N176K probably damaging Het
Fgd4 T C 16: 16,293,018 (GRCm39) Y233C probably benign Het
Foxd2 G A 4: 114,765,009 (GRCm39) A337V unknown Het
Gsdma2 T C 11: 98,548,547 (GRCm39) L433P unknown Het
Hmcn2 C A 2: 31,343,045 (GRCm39) probably null Het
Hnrnpul2 T C 19: 8,797,788 (GRCm39) V48A probably benign Het
Hsf1 T A 15: 76,383,387 (GRCm39) S396T probably benign Het
Htr5b G T 1: 121,455,487 (GRCm39) N144K probably damaging Het
Igkv9-120 T C 6: 68,027,172 (GRCm39) S29P probably damaging Het
Igsf10 T A 3: 59,236,549 (GRCm39) N1211Y possibly damaging Het
Kcnh1 A C 1: 191,959,447 (GRCm39) I334L probably benign Het
Laptm4b T C 15: 34,276,346 (GRCm39) I158T probably benign Het
Mgat4f A T 1: 134,318,250 (GRCm39) M341L probably benign Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nav3 T C 10: 109,539,213 (GRCm39) T2063A probably damaging Het
Nceh1 T A 3: 27,261,531 (GRCm39) D47E probably benign Het
Nckap5 A G 1: 125,952,383 (GRCm39) S1390P probably damaging Het
Npepps T G 11: 97,158,454 (GRCm39) I104L probably benign Het
Numb A G 12: 83,848,051 (GRCm39) S229P not run Het
Opn1sw T A 6: 29,380,168 (GRCm39) I83F probably benign Het
Or13p4 T C 4: 118,547,425 (GRCm39) S75G probably damaging Het
Or5b95 A T 19: 12,657,576 (GRCm39) I35F probably benign Het
Or5l13 G A 2: 87,779,822 (GRCm39) H252Y probably damaging Het
Pigg T G 5: 108,484,162 (GRCm39) C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pkhd1l1 C A 15: 44,391,133 (GRCm39) H1504N probably benign Het
Plcd4 A G 1: 74,604,292 (GRCm39) N757D possibly damaging Het
Ppia A G 11: 6,369,569 (GRCm39) T152A probably benign Het
Psmd8 G A 7: 28,878,346 (GRCm39) probably null Het
Pxn T A 5: 115,686,575 (GRCm39) Y356N probably benign Het
Rhoa G C 9: 108,213,914 (GRCm39) C159S probably damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rita1 C T 5: 120,749,506 (GRCm39) C69Y probably benign Het
Satb1 A G 17: 52,074,961 (GRCm39) S512P possibly damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Slc22a6 A G 19: 8,599,260 (GRCm39) K297R possibly damaging Het
Snrnp48 T C 13: 38,405,263 (GRCm39) Y287H probably benign Het
Sntg2 A T 12: 30,276,910 (GRCm39) C381S probably benign Het
Syngap1 T A 17: 27,178,938 (GRCm39) M649K probably damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Thap2 T C 10: 115,212,289 (GRCm39) I79V probably damaging Het
Thap7 T C 16: 17,346,467 (GRCm39) N172S probably benign Het
Ticrr A G 7: 79,328,844 (GRCm39) Y661C possibly damaging Het
Ttn T C 2: 76,606,659 (GRCm39) N18084D probably damaging Het
Usp48 A T 4: 137,377,728 (GRCm39) K1020M probably damaging Het
Vmn2r12 T C 5: 109,233,920 (GRCm39) N764S probably damaging Het
Wfdc6b T A 2: 164,459,339 (GRCm39) C134S probably damaging Het
Zcchc2 A T 1: 105,946,003 (GRCm39) D481V probably damaging Het
Zfp949 G A 9: 88,451,923 (GRCm39) G498R probably damaging Het
Other mutations in Vmn2r91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Vmn2r91 APN 17 18,325,820 (GRCm39) missense probably benign 0.00
IGL01121:Vmn2r91 APN 17 18,356,766 (GRCm39) missense possibly damaging 0.94
IGL01464:Vmn2r91 APN 17 18,327,864 (GRCm39) missense probably null 0.00
IGL02003:Vmn2r91 APN 17 18,327,921 (GRCm39) missense probably benign
IGL02709:Vmn2r91 APN 17 18,325,711 (GRCm39) missense possibly damaging 0.74
IGL02795:Vmn2r91 APN 17 18,305,539 (GRCm39) missense probably benign 0.01
IGL02813:Vmn2r91 APN 17 18,356,348 (GRCm39) missense possibly damaging 0.91
IGL02830:Vmn2r91 APN 17 18,356,884 (GRCm39) missense probably benign 0.01
IGL03130:Vmn2r91 APN 17 18,330,373 (GRCm39) splice site probably benign
BB006:Vmn2r91 UTSW 17 18,327,906 (GRCm39) missense probably damaging 1.00
BB016:Vmn2r91 UTSW 17 18,327,906 (GRCm39) missense probably damaging 1.00
R0164:Vmn2r91 UTSW 17 18,326,399 (GRCm39) missense probably benign 0.00
R0164:Vmn2r91 UTSW 17 18,326,399 (GRCm39) missense probably benign 0.00
R0393:Vmn2r91 UTSW 17 18,325,712 (GRCm39) missense probably damaging 1.00
R1142:Vmn2r91 UTSW 17 18,356,705 (GRCm39) missense probably damaging 1.00
R1603:Vmn2r91 UTSW 17 18,326,405 (GRCm39) missense probably benign 0.04
R1992:Vmn2r91 UTSW 17 18,356,142 (GRCm39) missense probably damaging 1.00
R2182:Vmn2r91 UTSW 17 18,325,691 (GRCm39) missense possibly damaging 0.94
R2424:Vmn2r91 UTSW 17 18,356,431 (GRCm39) nonsense probably null
R2512:Vmn2r91 UTSW 17 18,356,048 (GRCm39) missense probably benign
R2885:Vmn2r91 UTSW 17 18,325,628 (GRCm39) missense probably benign 0.00
R2909:Vmn2r91 UTSW 17 18,356,661 (GRCm39) missense probably damaging 1.00
R3009:Vmn2r91 UTSW 17 18,325,717 (GRCm39) missense probably benign 0.11
R3079:Vmn2r91 UTSW 17 18,355,973 (GRCm39) splice site probably null
R3080:Vmn2r91 UTSW 17 18,355,973 (GRCm39) splice site probably null
R3434:Vmn2r91 UTSW 17 18,330,370 (GRCm39) splice site probably benign
R3723:Vmn2r91 UTSW 17 18,305,540 (GRCm39) critical splice donor site probably null
R3829:Vmn2r91 UTSW 17 18,325,759 (GRCm39) missense probably damaging 1.00
R3845:Vmn2r91 UTSW 17 18,327,860 (GRCm39) missense probably benign 0.00
R3846:Vmn2r91 UTSW 17 18,327,860 (GRCm39) missense probably benign 0.00
R4118:Vmn2r91 UTSW 17 18,330,358 (GRCm39) missense probably damaging 1.00
R4285:Vmn2r91 UTSW 17 18,356,030 (GRCm39) missense probably benign 0.00
R4729:Vmn2r91 UTSW 17 18,327,906 (GRCm39) missense probably damaging 1.00
R4793:Vmn2r91 UTSW 17 18,325,658 (GRCm39) missense probably damaging 1.00
R4932:Vmn2r91 UTSW 17 18,356,751 (GRCm39) missense possibly damaging 0.84
R5016:Vmn2r91 UTSW 17 18,330,322 (GRCm39) nonsense probably null
R5018:Vmn2r91 UTSW 17 18,356,700 (GRCm39) missense probably damaging 1.00
R5605:Vmn2r91 UTSW 17 18,356,763 (GRCm39) missense probably damaging 1.00
R5815:Vmn2r91 UTSW 17 18,326,464 (GRCm39) missense probably benign 0.01
R6146:Vmn2r91 UTSW 17 18,356,518 (GRCm39) missense probably benign 0.07
R6187:Vmn2r91 UTSW 17 18,326,888 (GRCm39) missense probably benign 0.05
R6426:Vmn2r91 UTSW 17 18,355,865 (GRCm39) splice site probably null
R6450:Vmn2r91 UTSW 17 18,305,527 (GRCm39) missense probably damaging 0.98
R6767:Vmn2r91 UTSW 17 18,327,807 (GRCm39) missense probably damaging 0.98
R6986:Vmn2r91 UTSW 17 18,356,271 (GRCm39) missense probably benign 0.10
R7112:Vmn2r91 UTSW 17 18,325,880 (GRCm39) missense possibly damaging 0.83
R7178:Vmn2r91 UTSW 17 18,356,424 (GRCm39) missense probably damaging 1.00
R7330:Vmn2r91 UTSW 17 18,326,429 (GRCm39) missense probably damaging 1.00
R7368:Vmn2r91 UTSW 17 18,356,540 (GRCm39) missense possibly damaging 0.75
R7380:Vmn2r91 UTSW 17 18,356,838 (GRCm39) nonsense probably null
R7397:Vmn2r91 UTSW 17 18,356,060 (GRCm39) missense probably benign 0.02
R7625:Vmn2r91 UTSW 17 18,325,693 (GRCm39) missense probably damaging 1.00
R7739:Vmn2r91 UTSW 17 18,356,080 (GRCm39) missense probably benign 0.00
R7755:Vmn2r91 UTSW 17 18,330,311 (GRCm39) missense possibly damaging 0.88
R7929:Vmn2r91 UTSW 17 18,327,906 (GRCm39) missense probably damaging 1.00
R7981:Vmn2r91 UTSW 17 18,327,887 (GRCm39) missense probably benign 0.02
R8211:Vmn2r91 UTSW 17 18,326,762 (GRCm39) missense probably damaging 1.00
R8325:Vmn2r91 UTSW 17 18,356,625 (GRCm39) missense probably damaging 1.00
R8781:Vmn2r91 UTSW 17 18,305,323 (GRCm39) missense possibly damaging 0.78
R8974:Vmn2r91 UTSW 17 18,325,636 (GRCm39) missense probably benign 0.27
R9047:Vmn2r91 UTSW 17 18,326,296 (GRCm39) missense probably benign 0.00
R9048:Vmn2r91 UTSW 17 18,356,122 (GRCm39) missense probably benign 0.00
R9109:Vmn2r91 UTSW 17 18,327,905 (GRCm39) missense probably damaging 1.00
R9211:Vmn2r91 UTSW 17 18,356,819 (GRCm39) nonsense probably null
R9555:Vmn2r91 UTSW 17 18,325,792 (GRCm39) missense possibly damaging 0.78
R9616:Vmn2r91 UTSW 17 18,356,305 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCCACTGTGTTGGCCAAAAC -3'
(R):5'- CCCTTTAGTGCTGTGGTAGAC -3'

Sequencing Primer
(F):5'- GTGTTGGCCAAAACTATTACAGTGG -3'
(R):5'- CAGGAAGAAAGGTGACCCAGAC -3'
Posted On 2019-11-26