Incidental Mutation 'R7749:Vmn2r91'
ID 597120
Institutional Source Beutler Lab
Gene Symbol Vmn2r91
Ensembl Gene ENSMUSG00000091206
Gene Name vomeronasal 2, receptor 91
Synonyms EG665210
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R7749 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 18085057-18136643 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18136278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 736 (I736V)
Ref Sequence ENSEMBL: ENSMUSP00000127465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172359]
AlphaFold E9Q2U5
Predicted Effect possibly damaging
Transcript: ENSMUST00000172359
AA Change: I736V

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127465
Gene: ENSMUSG00000091206
AA Change: I736V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 462 2.2e-38 PFAM
Pfam:NCD3G 510 564 6.7e-20 PFAM
Pfam:7tm_3 597 832 2.1e-53 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A T 1: 134,390,512 M341L probably benign Het
Actr1a A T 19: 46,379,747 S254T probably benign Het
Adam12 G A 7: 134,224,813 A22V unknown Het
Adarb2 A G 13: 8,569,739 D87G possibly damaging Het
Aldh6a1 A T 12: 84,442,081 I59N probably benign Het
Ankrd50 C T 3: 38,482,721 C161Y probably damaging Het
Ankrd7 A G 6: 18,879,516 probably null Het
Anks1 T A 17: 28,038,141 I707N probably damaging Het
Atoh1 A T 6: 64,729,920 M200L possibly damaging Het
Bmp1 C T 14: 70,492,844 R416H probably damaging Het
Caprin1 A G 2: 103,771,754 S548P probably benign Het
Ccdc167 T A 17: 29,705,273 Y63F possibly damaging Het
Cfap99 T A 5: 34,307,940 D174E probably benign Het
Chil3 T G 3: 106,148,845 N331T probably benign Het
Chmp5 T A 4: 40,949,488 I35N probably damaging Het
Cpt1c A T 7: 44,962,265 S537T probably benign Het
Dctn1 A T 6: 83,186,141 probably benign Het
Dhx57 T A 17: 80,238,858 M1366L probably benign Het
Dnah9 T A 11: 65,911,830 Y3478F probably damaging Het
Efna3 A G 3: 89,316,640 Y81H probably damaging Het
Eif4enif1 T C 11: 3,242,608 V812A probably damaging Het
Erg A T 16: 95,377,357 I237N probably benign Het
Fem1c G T 18: 46,524,118 N176K probably damaging Het
Fgd4 T C 16: 16,475,154 Y233C probably benign Het
Foxd2 G A 4: 114,907,812 A337V unknown Het
Gsdma2 T C 11: 98,657,721 L433P unknown Het
Hmcn2 C A 2: 31,453,033 probably null Het
Hnrnpul2 T C 19: 8,820,424 V48A probably benign Het
Hsf1 T A 15: 76,499,187 S396T probably benign Het
Htr5b G T 1: 121,527,758 N144K probably damaging Het
Igkv9-120 T C 6: 68,050,188 S29P probably damaging Het
Igsf10 T A 3: 59,329,128 N1211Y possibly damaging Het
Kcnh1 A C 1: 192,277,139 I334L probably benign Het
Laptm4b T C 15: 34,276,200 I158T probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,703,352 T2063A probably damaging Het
Nceh1 T A 3: 27,207,382 D47E probably benign Het
Nckap5 A G 1: 126,024,646 S1390P probably damaging Het
Npepps T G 11: 97,267,628 I104L probably benign Het
Numb A G 12: 83,801,277 S229P not run Het
Olfr1156 G A 2: 87,949,478 H252Y probably damaging Het
Olfr1342 T C 4: 118,690,228 S75G probably damaging Het
Olfr1443 A T 19: 12,680,212 I35F probably benign Het
Opn1sw T A 6: 29,380,169 I83F probably benign Het
Pigg T G 5: 108,336,296 C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 C A 15: 44,527,737 H1504N probably benign Het
Plcd4 A G 1: 74,565,133 N757D possibly damaging Het
Ppia A G 11: 6,419,569 T152A probably benign Het
Psmd8 G A 7: 29,178,921 probably null Het
Pxn T A 5: 115,548,516 Y356N probably benign Het
Rhoa G C 9: 108,336,715 C159S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rita1 C T 5: 120,611,441 C69Y probably benign Het
Satb1 A G 17: 51,767,933 S512P possibly damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Slc22a6 A G 19: 8,621,896 K297R possibly damaging Het
Snrnp48 T C 13: 38,221,287 Y287H probably benign Het
Sntg2 A T 12: 30,226,911 C381S probably benign Het
Syngap1 T A 17: 26,959,964 M649K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thap2 T C 10: 115,376,384 I79V probably damaging Het
Thap7 T C 16: 17,528,603 N172S probably benign Het
Ticrr A G 7: 79,679,096 Y661C possibly damaging Het
Ttn T C 2: 76,776,315 N18084D probably damaging Het
Usp48 A T 4: 137,650,417 K1020M probably damaging Het
Vmn2r12 T C 5: 109,086,054 N764S probably damaging Het
Wfdc6b T A 2: 164,617,419 C134S probably damaging Het
Zcchc2 A T 1: 106,018,273 D481V probably damaging Het
Zfp949 G A 9: 88,569,870 G498R probably damaging Het
Other mutations in Vmn2r91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Vmn2r91 APN 17 18105558 missense probably benign 0.00
IGL01121:Vmn2r91 APN 17 18136504 missense possibly damaging 0.94
IGL01464:Vmn2r91 APN 17 18107602 missense probably null 0.00
IGL02003:Vmn2r91 APN 17 18107659 missense probably benign
IGL02709:Vmn2r91 APN 17 18105449 missense possibly damaging 0.74
IGL02795:Vmn2r91 APN 17 18085277 missense probably benign 0.01
IGL02813:Vmn2r91 APN 17 18136086 missense possibly damaging 0.91
IGL02830:Vmn2r91 APN 17 18136622 missense probably benign 0.01
IGL03130:Vmn2r91 APN 17 18110111 splice site probably benign
BB006:Vmn2r91 UTSW 17 18107644 missense probably damaging 1.00
BB016:Vmn2r91 UTSW 17 18107644 missense probably damaging 1.00
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0393:Vmn2r91 UTSW 17 18105450 missense probably damaging 1.00
R1142:Vmn2r91 UTSW 17 18136443 missense probably damaging 1.00
R1603:Vmn2r91 UTSW 17 18106143 missense probably benign 0.04
R1992:Vmn2r91 UTSW 17 18135880 missense probably damaging 1.00
R2182:Vmn2r91 UTSW 17 18105429 missense possibly damaging 0.94
R2424:Vmn2r91 UTSW 17 18136169 nonsense probably null
R2512:Vmn2r91 UTSW 17 18135786 missense probably benign
R2885:Vmn2r91 UTSW 17 18105366 missense probably benign 0.00
R2909:Vmn2r91 UTSW 17 18136399 missense probably damaging 1.00
R3009:Vmn2r91 UTSW 17 18105455 missense probably benign 0.11
R3079:Vmn2r91 UTSW 17 18135711 splice site probably null
R3080:Vmn2r91 UTSW 17 18135711 splice site probably null
R3434:Vmn2r91 UTSW 17 18110108 splice site probably benign
R3723:Vmn2r91 UTSW 17 18085278 critical splice donor site probably null
R3829:Vmn2r91 UTSW 17 18105497 missense probably damaging 1.00
R3845:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R3846:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R4118:Vmn2r91 UTSW 17 18110096 missense probably damaging 1.00
R4285:Vmn2r91 UTSW 17 18135768 missense probably benign 0.00
R4729:Vmn2r91 UTSW 17 18107644 missense probably damaging 1.00
R4793:Vmn2r91 UTSW 17 18105396 missense probably damaging 1.00
R4932:Vmn2r91 UTSW 17 18136489 missense possibly damaging 0.84
R5016:Vmn2r91 UTSW 17 18110060 nonsense probably null
R5018:Vmn2r91 UTSW 17 18136438 missense probably damaging 1.00
R5605:Vmn2r91 UTSW 17 18136501 missense probably damaging 1.00
R5815:Vmn2r91 UTSW 17 18106202 missense probably benign 0.01
R6146:Vmn2r91 UTSW 17 18136256 missense probably benign 0.07
R6187:Vmn2r91 UTSW 17 18106626 missense probably benign 0.05
R6426:Vmn2r91 UTSW 17 18135603 splice site probably null
R6450:Vmn2r91 UTSW 17 18085265 missense probably damaging 0.98
R6767:Vmn2r91 UTSW 17 18107545 missense probably damaging 0.98
R6986:Vmn2r91 UTSW 17 18136009 missense probably benign 0.10
R7112:Vmn2r91 UTSW 17 18105618 missense possibly damaging 0.83
R7178:Vmn2r91 UTSW 17 18136162 missense probably damaging 1.00
R7330:Vmn2r91 UTSW 17 18106167 missense probably damaging 1.00
R7368:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7380:Vmn2r91 UTSW 17 18136576 nonsense probably null
R7397:Vmn2r91 UTSW 17 18135798 missense probably benign 0.02
R7625:Vmn2r91 UTSW 17 18105431 missense probably damaging 1.00
R7739:Vmn2r91 UTSW 17 18135818 missense probably benign 0.00
R7755:Vmn2r91 UTSW 17 18110049 missense possibly damaging 0.88
R7929:Vmn2r91 UTSW 17 18107644 missense probably damaging 1.00
R7981:Vmn2r91 UTSW 17 18107625 missense probably benign 0.02
R8211:Vmn2r91 UTSW 17 18106500 missense probably damaging 1.00
R8325:Vmn2r91 UTSW 17 18136363 missense probably damaging 1.00
R8781:Vmn2r91 UTSW 17 18085061 missense possibly damaging 0.78
R8974:Vmn2r91 UTSW 17 18105374 missense probably benign 0.27
R9047:Vmn2r91 UTSW 17 18106034 missense probably benign 0.00
R9048:Vmn2r91 UTSW 17 18135860 missense probably benign 0.00
R9109:Vmn2r91 UTSW 17 18107643 missense probably damaging 1.00
R9211:Vmn2r91 UTSW 17 18136557 nonsense probably null
R9555:Vmn2r91 UTSW 17 18105530 missense possibly damaging 0.78
R9616:Vmn2r91 UTSW 17 18136043 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCCACTGTGTTGGCCAAAAC -3'
(R):5'- CCCTTTAGTGCTGTGGTAGAC -3'

Sequencing Primer
(F):5'- GTGTTGGCCAAAACTATTACAGTGG -3'
(R):5'- CAGGAAGAAAGGTGACCCAGAC -3'
Posted On 2019-11-26