Incidental Mutation 'R7749:Satb1'
ID597124
Institutional Source Beutler Lab
Gene Symbol Satb1
Ensembl Gene ENSMUSG00000023927
Gene Namespecial AT-rich sequence binding protein 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7749 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location51736187-51833290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51767933 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 512 (S512P)
Ref Sequence ENSEMBL: ENSMUSP00000116006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129667] [ENSMUST00000133574] [ENSMUST00000140979] [ENSMUST00000144331] [ENSMUST00000152830] [ENSMUST00000169480] [ENSMUST00000176669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000129667
AA Change: S512P

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116020
Gene: ENSMUSG00000023927
AA Change: S512P

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 619 N/A INTRINSIC
HOX 644 707 6.73e-10 SMART
low complexity region 720 730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133574
AA Change: S512P

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120536
Gene: ENSMUSG00000023927
AA Change: S512P

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140979
AA Change: S512P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118839
Gene: ENSMUSG00000023927
AA Change: S512P

DomainStartEndE-ValueType
Pfam:ULD 72 170 3.2e-40 PFAM
Pfam:CUTL 176 247 1.6e-46 PFAM
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 616 661 N/A INTRINSIC
HOX 676 739 6.73e-10 SMART
low complexity region 752 762 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144331
AA Change: S512P

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116006
Gene: ENSMUSG00000023927
AA Change: S512P

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152830
AA Change: S512P

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119842
Gene: ENSMUSG00000023927
AA Change: S512P

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169480
AA Change: S512P

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128841
Gene: ENSMUSG00000023927
AA Change: S512P

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176669
AA Change: S512P

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134957
Gene: ENSMUSG00000023927
AA Change: S512P

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a matrix protein which binds nuclear matrix and scaffold-associating DNAs through a unique nuclear architecture. The protein recruits chromatin-remodeling factors in order to regulate chromatin structure and gene expression. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mice for a targeted null mutation exhibit reduced size of the lymphoid organs, abnormal T cell development, general growth retardation and die by 3-4 weeks of age. Mice homozegous for a different targeted allele exhibit postnatal growth retardation and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A T 1: 134,390,512 M341L probably benign Het
Actr1a A T 19: 46,379,747 S254T probably benign Het
Adam12 G A 7: 134,224,813 A22V unknown Het
Adarb2 A G 13: 8,569,739 D87G possibly damaging Het
Aldh6a1 A T 12: 84,442,081 I59N probably benign Het
Ankrd50 C T 3: 38,482,721 C161Y probably damaging Het
Anks1 T A 17: 28,038,141 I707N probably damaging Het
Atoh1 A T 6: 64,729,920 M200L possibly damaging Het
Bmp1 C T 14: 70,492,844 R416H probably damaging Het
Caprin1 A G 2: 103,771,754 S548P probably benign Het
Ccdc167 T A 17: 29,705,273 Y63F possibly damaging Het
Cfap99 T A 5: 34,307,940 D174E probably benign Het
Chil3 T G 3: 106,148,845 N331T probably benign Het
Chmp5 T A 4: 40,949,488 I35N probably damaging Het
Cpt1c A T 7: 44,962,265 S537T probably benign Het
Dhx57 T A 17: 80,238,858 M1366L probably benign Het
Dnah9 T A 11: 65,911,830 Y3478F probably damaging Het
Efna3 A G 3: 89,316,640 Y81H probably damaging Het
Eif4enif1 T C 11: 3,242,608 V812A probably damaging Het
Erg A T 16: 95,377,357 I237N probably benign Het
Fem1c G T 18: 46,524,118 N176K probably damaging Het
Fgd4 T C 16: 16,475,154 Y233C probably benign Het
Foxd2 G A 4: 114,907,812 A337V unknown Het
Gsdma2 T C 11: 98,657,721 L433P unknown Het
Hnrnpul2 T C 19: 8,820,424 V48A probably benign Het
Hsf1 T A 15: 76,499,187 S396T probably benign Het
Htr5b G T 1: 121,527,758 N144K probably damaging Het
Igkv9-120 T C 6: 68,050,188 S29P probably damaging Het
Igsf10 T A 3: 59,329,128 N1211Y possibly damaging Het
Kcnh1 A C 1: 192,277,139 I334L probably benign Het
Laptm4b T C 15: 34,276,200 I158T probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,703,352 T2063A probably damaging Het
Nckap5 A G 1: 126,024,646 S1390P probably damaging Het
Npepps T G 11: 97,267,628 I104L probably benign Het
Numb A G 12: 83,801,277 S229P not run Het
Olfr1156 G A 2: 87,949,478 H252Y probably damaging Het
Olfr1342 T C 4: 118,690,228 S75G probably damaging Het
Olfr1443 A T 19: 12,680,212 I35F probably benign Het
Opn1sw T A 6: 29,380,169 I83F probably benign Het
Pigg T G 5: 108,336,296 C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 C A 15: 44,527,737 H1504N probably benign Het
Plcd4 A G 1: 74,565,133 N757D possibly damaging Het
Ppia A G 11: 6,419,569 T152A probably benign Het
Pxn T A 5: 115,548,516 Y356N probably benign Het
Rhoa G C 9: 108,336,715 C159S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rita1 C T 5: 120,611,441 C69Y probably benign Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Slc22a6 A G 19: 8,621,896 K297R possibly damaging Het
Snrnp48 T C 13: 38,221,287 Y287H probably benign Het
Sntg2 A T 12: 30,226,911 C381S probably benign Het
Syngap1 T A 17: 26,959,964 M649K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thap2 T C 10: 115,376,384 I79V probably damaging Het
Thap7 T C 16: 17,528,603 N172S probably benign Het
Ticrr A G 7: 79,679,096 Y661C possibly damaging Het
Ttn T C 2: 76,776,315 N18084D probably damaging Het
Usp48 A T 4: 137,650,417 K1020M probably damaging Het
Vmn2r12 T C 5: 109,086,054 N764S probably damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Wfdc6b T A 2: 164,617,419 C134S probably damaging Het
Zcchc2 A T 1: 106,018,273 D481V probably damaging Het
Zfp949 G A 9: 88,569,870 G498R probably damaging Het
Other mutations in Satb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Satb1 APN 17 51805289 missense probably damaging 1.00
IGL01658:Satb1 APN 17 51775251 missense probably benign 0.33
IGL02070:Satb1 APN 17 51740067 missense probably damaging 0.98
IGL02212:Satb1 APN 17 51775291 missense possibly damaging 0.82
IGL02971:Satb1 APN 17 51742689 missense possibly damaging 0.62
R0049:Satb1 UTSW 17 51740346 missense probably benign 0.28
R0056:Satb1 UTSW 17 51740203 missense probably damaging 1.00
R0060:Satb1 UTSW 17 51740203 missense probably damaging 1.00
R0067:Satb1 UTSW 17 51804336 missense probably damaging 1.00
R0067:Satb1 UTSW 17 51804336 missense probably damaging 1.00
R0113:Satb1 UTSW 17 51782698 nonsense probably null
R0347:Satb1 UTSW 17 51739906 nonsense probably null
R0667:Satb1 UTSW 17 51782861 missense probably damaging 1.00
R1436:Satb1 UTSW 17 51804363 unclassified probably null
R1595:Satb1 UTSW 17 51782701 missense possibly damaging 0.82
R1686:Satb1 UTSW 17 51739999 missense probably benign 0.08
R1921:Satb1 UTSW 17 51742115 nonsense probably null
R1952:Satb1 UTSW 17 51740145 missense probably damaging 1.00
R2012:Satb1 UTSW 17 51782788 nonsense probably null
R2156:Satb1 UTSW 17 51740410 missense probably benign 0.02
R2180:Satb1 UTSW 17 51803496 missense probably damaging 0.96
R2959:Satb1 UTSW 17 51775303 missense possibly damaging 0.91
R3107:Satb1 UTSW 17 51782782 missense possibly damaging 0.95
R3108:Satb1 UTSW 17 51782782 missense possibly damaging 0.95
R3814:Satb1 UTSW 17 51782907 missense probably damaging 0.98
R4109:Satb1 UTSW 17 51804350 missense probably damaging 0.99
R4727:Satb1 UTSW 17 51804347 missense probably damaging 1.00
R5209:Satb1 UTSW 17 51809207 missense probably benign 0.26
R5652:Satb1 UTSW 17 51742795 missense probably damaging 1.00
R5815:Satb1 UTSW 17 51782953 missense possibly damaging 0.92
R6141:Satb1 UTSW 17 51775376 missense possibly damaging 0.93
R6370:Satb1 UTSW 17 51782797 missense possibly damaging 0.94
R7371:Satb1 UTSW 17 51782980 nonsense probably null
R7409:Satb1 UTSW 17 51809189 missense possibly damaging 0.90
R7471:Satb1 UTSW 17 51783001 missense probably damaging 0.96
R7568:Satb1 UTSW 17 51782724 missense possibly damaging 0.88
R7626:Satb1 UTSW 17 51767967 missense probably benign 0.25
R7863:Satb1 UTSW 17 51805322 missense possibly damaging 0.91
R7946:Satb1 UTSW 17 51805322 missense possibly damaging 0.91
Z1088:Satb1 UTSW 17 51782939 missense probably damaging 0.99
Z1088:Satb1 UTSW 17 51782952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACCAGGAAACGGAATGTCTAC -3'
(R):5'- TGAGAAGCTCTGAATCAATTTGGC -3'

Sequencing Primer
(F):5'- GGAAACGGAATGTCTACAACCTAC -3'
(R):5'- TTGGCTAATGAAAAATGACAGCCAC -3'
Posted On2019-11-26