Incidental Mutation 'R7749:Dhx57'
ID 597125
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R7749 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 80238304-80290476 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80238858 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1366 (M1366L)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably benign
Transcript: ENSMUST00000038166
AA Change: M1313L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: M1313L

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086555
AA Change: M1366L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: M1366L

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (66/67)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A T 1: 134,390,512 M341L probably benign Het
Actr1a A T 19: 46,379,747 S254T probably benign Het
Adam12 G A 7: 134,224,813 A22V unknown Het
Adarb2 A G 13: 8,569,739 D87G possibly damaging Het
Aldh6a1 A T 12: 84,442,081 I59N probably benign Het
Ankrd50 C T 3: 38,482,721 C161Y probably damaging Het
Ankrd7 A G 6: 18,879,516 probably null Het
Anks1 T A 17: 28,038,141 I707N probably damaging Het
Atoh1 A T 6: 64,729,920 M200L possibly damaging Het
Bmp1 C T 14: 70,492,844 R416H probably damaging Het
Caprin1 A G 2: 103,771,754 S548P probably benign Het
Ccdc167 T A 17: 29,705,273 Y63F possibly damaging Het
Cfap99 T A 5: 34,307,940 D174E probably benign Het
Chil3 T G 3: 106,148,845 N331T probably benign Het
Chmp5 T A 4: 40,949,488 I35N probably damaging Het
Cpt1c A T 7: 44,962,265 S537T probably benign Het
Dctn1 A T 6: 83,186,141 probably benign Het
Dnah9 T A 11: 65,911,830 Y3478F probably damaging Het
Efna3 A G 3: 89,316,640 Y81H probably damaging Het
Eif4enif1 T C 11: 3,242,608 V812A probably damaging Het
Erg A T 16: 95,377,357 I237N probably benign Het
Fem1c G T 18: 46,524,118 N176K probably damaging Het
Fgd4 T C 16: 16,475,154 Y233C probably benign Het
Foxd2 G A 4: 114,907,812 A337V unknown Het
Gsdma2 T C 11: 98,657,721 L433P unknown Het
Hmcn2 C A 2: 31,453,033 probably null Het
Hnrnpul2 T C 19: 8,820,424 V48A probably benign Het
Hsf1 T A 15: 76,499,187 S396T probably benign Het
Htr5b G T 1: 121,527,758 N144K probably damaging Het
Igkv9-120 T C 6: 68,050,188 S29P probably damaging Het
Igsf10 T A 3: 59,329,128 N1211Y possibly damaging Het
Kcnh1 A C 1: 192,277,139 I334L probably benign Het
Laptm4b T C 15: 34,276,200 I158T probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,703,352 T2063A probably damaging Het
Nceh1 T A 3: 27,207,382 D47E probably benign Het
Nckap5 A G 1: 126,024,646 S1390P probably damaging Het
Npepps T G 11: 97,267,628 I104L probably benign Het
Numb A G 12: 83,801,277 S229P not run Het
Olfr1156 G A 2: 87,949,478 H252Y probably damaging Het
Olfr1342 T C 4: 118,690,228 S75G probably damaging Het
Olfr1443 A T 19: 12,680,212 I35F probably benign Het
Opn1sw T A 6: 29,380,169 I83F probably benign Het
Pigg T G 5: 108,336,296 C603G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1l1 C A 15: 44,527,737 H1504N probably benign Het
Plcd4 A G 1: 74,565,133 N757D possibly damaging Het
Ppia A G 11: 6,419,569 T152A probably benign Het
Psmd8 G A 7: 29,178,921 probably null Het
Pxn T A 5: 115,548,516 Y356N probably benign Het
Rhoa G C 9: 108,336,715 C159S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rita1 C T 5: 120,611,441 C69Y probably benign Het
Satb1 A G 17: 51,767,933 S512P possibly damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Slc22a6 A G 19: 8,621,896 K297R possibly damaging Het
Snrnp48 T C 13: 38,221,287 Y287H probably benign Het
Sntg2 A T 12: 30,226,911 C381S probably benign Het
Syngap1 T A 17: 26,959,964 M649K probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Thap2 T C 10: 115,376,384 I79V probably damaging Het
Thap7 T C 16: 17,528,603 N172S probably benign Het
Ticrr A G 7: 79,679,096 Y661C possibly damaging Het
Ttn T C 2: 76,776,315 N18084D probably damaging Het
Usp48 A T 4: 137,650,417 K1020M probably damaging Het
Vmn2r12 T C 5: 109,086,054 N764S probably damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Wfdc6b T A 2: 164,617,419 C134S probably damaging Het
Zcchc2 A T 1: 106,018,273 D481V probably damaging Het
Zfp949 G A 9: 88,569,870 G498R probably damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80274976 missense probably benign 0.00
IGL00811:Dhx57 APN 17 80253243 missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80281223 missense probably benign 0.28
IGL01468:Dhx57 APN 17 80255610 nonsense probably null
IGL01908:Dhx57 APN 17 80251443 missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80268850 missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80260323 missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80274839 missense probably benign 0.13
IGL02349:Dhx57 APN 17 80255571 missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80255550 critical splice donor site probably null
IGL02588:Dhx57 APN 17 80268871 missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80267545 missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80267549 missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80247152 missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80258097 missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80275191 missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80263975 missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80238914 missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80251473 missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80274881 missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80258121 missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80274797 missense probably benign 0.34
R0520:Dhx57 UTSW 17 80258175 missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80260236 nonsense probably null
R0661:Dhx57 UTSW 17 80268864 missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80270371 missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80275582 missense probably benign
R0963:Dhx57 UTSW 17 80275527 missense probably benign 0.01
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80245728 missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80275226 missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80253085 critical splice donor site probably null
R1853:Dhx57 UTSW 17 80274879 nonsense probably null
R1942:Dhx57 UTSW 17 80265144 missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80253080 splice site probably benign
R2106:Dhx57 UTSW 17 80275363 missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80273048 missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80275331 missense probably benign 0.07
R2249:Dhx57 UTSW 17 80281234 missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80260416 missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80254304 missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80241949 splice site probably null
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2874:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R3819:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R3964:Dhx57 UTSW 17 80265112 nonsense probably null
R4535:Dhx57 UTSW 17 80275082 missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80274961 missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80275331 missense probably benign 0.01
R4822:Dhx57 UTSW 17 80242167 splice site probably null
R4863:Dhx57 UTSW 17 80253111 missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80251398 missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80275081 missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80254379 missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80238873 missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80245806 missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80263946 critical splice donor site probably null
R6177:Dhx57 UTSW 17 80272966 missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80274805 missense probably benign 0.00
R6802:Dhx57 UTSW 17 80275321 missense probably benign 0.43
R6924:Dhx57 UTSW 17 80238815 missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80273047 missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80267577 missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80255571 missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80247113 missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80274861 missense probably benign 0.06
R7733:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R7748:Dhx57 UTSW 17 80265117 missense probably damaging 1.00
R7772:Dhx57 UTSW 17 80273078 missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80245763 missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80275490 missense probably benign 0.18
R8403:Dhx57 UTSW 17 80278289 missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80254424 missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80270365 critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80268909 missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80268909 missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80242094 missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80254388 missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80245701 missense probably benign 0.09
R9717:Dhx57 UTSW 17 80275018 missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80251348 missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80245805 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAGTGTGGAGACTGTCTCTTG -3'
(R):5'- GTTACAGAGTGAAAGCGTGTTC -3'

Sequencing Primer
(F):5'- CTGGCTCTGCACCCCAG -3'
(R):5'- AGCGTGTTCTAAAGTACTGTCAGAG -3'
Posted On 2019-11-26