Mutagenetix > Incidental Mutation

Incidental Mutation 'R0632:Tacc2'

59715

Institutional Source

Beutler Lab

Gene Symbol

Tacc2

Ensembl Gene

ENSMUSG00000030852

Gene Name

transforming, acidic coiled-coil containing protein 2

Synonyms

MMRRC Submission

038821-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0632 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130577438-130764785 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 130625595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1356 (K1356*)

Ref Sequence

ENSEMBL: ENSMUSP00000149733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207789] [ENSMUST00000207918] [ENSMUST00000208722] [ENSMUST00000215492]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000059145

SMART Domains

Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852

Domain	Start	End	E-Value	Type
low complexity region	87	102	N/A	INTRINSIC
low complexity region	147	173	N/A	INTRINSIC
internal_repeat_1	181	291	2.03e-5	PROSPERO
low complexity region	345	356	N/A	INTRINSIC
internal_repeat_1	483	566	2.03e-5	PROSPERO
low complexity region	571	586	N/A	INTRINSIC
low complexity region	603	614	N/A	INTRINSIC
low complexity region	648	662	N/A	INTRINSIC
coiled coil region	873	900	N/A	INTRINSIC
Pfam:TACC	939	1145	4e-85	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000084513
AA Change: K1337*

SMART Domains

Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: K1337*

Domain	Start	End	E-Value	Type
internal_repeat_1	19	346	3.83e-6	PROSPERO
low complexity region	398	410	N/A	INTRINSIC
low complexity region	413	431	N/A	INTRINSIC
internal_repeat_1	778	1068	3.83e-6	PROSPERO
low complexity region	1397	1415	N/A	INTRINSIC
low complexity region	1723	1739	N/A	INTRINSIC
low complexity region	1794	1809	N/A	INTRINSIC
low complexity region	1854	1880	N/A	INTRINSIC
low complexity region	2052	2063	N/A	INTRINSIC
low complexity region	2278	2293	N/A	INTRINSIC
low complexity region	2310	2321	N/A	INTRINSIC
low complexity region	2355	2369	N/A	INTRINSIC
coiled coil region	2606	2633	N/A	INTRINSIC
Pfam:TACC	2673	2873	6.1e-87	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207789

Predicted Effect

probably null
Transcript: ENSMUST00000207918
AA Change: K1337*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207999

Predicted Effect

probably benign
Transcript: ENSMUST00000208722

Predicted Effect

probably null
Transcript: ENSMUST00000215492
AA Change: K1356*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

95% (81/85)

MGI Phenotype

FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	C	1: 136,227,618	D83G	probably benign	Het
Acaa1a	T	A	9: 119,347,818		probably benign	Het
Adgrg7	T	A	16: 56,742,589	T462S	possibly damaging	Het
Akap6	A	T	12: 52,937,148	N825I	probably damaging	Het
Ankib1	T	A	5: 3,772,529	N59I	probably benign	Het
Anks6	T	C	4: 47,033,167	S633G	possibly damaging	Het
Ap4e1	C	A	2: 127,049,280	Y522*	probably null	Het
Art5	G	A	7: 102,097,957	T205I	probably damaging	Het
Ascc2	T	A	11: 4,649,855	L176H	probably damaging	Het
Atp13a5	T	C	16: 29,298,208	D529G	probably benign	Het
C2cd4a	T	C	9: 67,831,563	E66G	probably benign	Het
C8a	T	C	4: 104,856,492	D147G	probably damaging	Het
Ccdc14	T	C	16: 34,721,649	V532A	possibly damaging	Het
Ccdc88a	T	A	11: 29,482,749		probably benign	Het
Cfap54	C	T	10: 92,885,096	E2543K	unknown	Het
Cldn13	C	T	5: 134,914,747	E195K	probably benign	Het
Cp	A	G	3: 19,971,082	S402G	probably null	Het
Cpa3	T	C	3: 20,225,194	T194A	probably benign	Het
Crygf	C	A	1: 65,927,997	Y93*	probably null	Het
Ctsh	A	G	9: 90,061,582	R87G	possibly damaging	Het
Cyp2t4	A	G	7: 27,158,246	D428G	possibly damaging	Het
Dnah17	C	G	11: 118,067,682		probably benign	Het
Dnah3	A	G	7: 119,967,905	V2366A	probably benign	Het
Dscaml1	A	T	9: 45,732,134	I1284F	probably benign	Het
Dsg1c	T	C	18: 20,272,346		probably benign	Het
Dst	G	T	1: 34,271,413	R4098L	probably damaging	Het
Efhb	A	G	17: 53,413,459		probably benign	Het
Epha7	A	T	4: 28,821,104	I90F	probably damaging	Het
Fam171a2	T	A	11: 102,437,881	D684V	probably damaging	Het
Fan1	A	G	7: 64,363,199	V665A	possibly damaging	Het
Fbn2	A	G	18: 58,037,747	C2191R	probably damaging	Het
Fkbp3	G	A	12: 65,073,918	A2V	probably benign	Het
G6pd2	A	G	5: 61,810,171	N430D	probably benign	Het
Gm13119	G	A	4: 144,363,782	C464Y	probably damaging	Het
Gm13547	T	A	2: 29,761,584	D7E	possibly damaging	Het
Hdac5	A	T	11: 102,205,812	D260E	probably damaging	Het
Hist1h4i	G	T	13: 22,041,027	Y99*	probably null	Het
Hsf2bp	T	C	17: 32,013,346	E142G	probably damaging	Het
Igf1r	C	T	7: 68,165,155	T268I	probably damaging	Het
Kcne3	C	T	7: 100,184,439	R88C	probably damaging	Het
Klk1b9	G	T	7: 43,979,372	G100V	possibly damaging	Het
Kmt2d	G	A	15: 98,853,581		probably benign	Het
Lama1	C	T	17: 67,752,368		probably benign	Het
Lcp2	C	T	11: 34,082,426	P335S	possibly damaging	Het
Lrrk2	T	A	15: 91,796,028	N2047K	probably damaging	Het
Mcub	T	C	3: 129,918,726	M167V	probably benign	Het
Mia2	T	C	12: 59,136,143	L36P	probably damaging	Het
Mmp13	G	A	9: 7,274,032	G169R	probably damaging	Het
Mmp13	A	T	9: 7,282,077	I460F	possibly damaging	Het
Msh4	A	G	3: 153,896,895	I232T	probably damaging	Het
Msra	T	A	14: 64,210,532	M145L	probably benign	Het
Myo7a	A	T	7: 98,112,150		probably benign	Het
Nme8	A	T	13: 19,658,036	N422K	probably damaging	Het
Nol6	A	T	4: 41,121,115	F353I	probably damaging	Het
Nphp3	A	G	9: 104,018,274	K384E	probably damaging	Het
Olfr572	C	T	7: 102,928,604		probably null	Het
Olfr652	A	G	7: 104,564,337	I39V	probably benign	Het
Olfr672	A	G	7: 104,996,703	I67T	probably benign	Het
Phox2b	T	G	5: 67,096,214		probably benign	Het
Plec	A	T	15: 76,173,411	S4131T	probably damaging	Het
Pptc7	G	A	5: 122,313,591		probably benign	Het
Prpf40b	A	G	15: 99,316,289	E810G	probably benign	Het
Ptprc	C	T	1: 138,073,610	V965I	probably benign	Het
Pum1	T	A	4: 130,728,104	M180K	probably benign	Het
Ranbp3	T	C	17: 56,702,896		probably benign	Het
Rasgrf2	A	G	13: 91,972,274	S787P	probably benign	Het
Rnf19b	T	A	4: 129,073,551	N294K	probably damaging	Het
Samd3	A	T	10: 26,244,495	H156L	possibly damaging	Het
Serpinb6c	C	T	13: 33,880,031	R347Q	possibly damaging	Het
Slc36a3	A	G	11: 55,125,080	I416T	probably damaging	Het
Slc4a4	T	A	5: 89,129,641	F279Y	probably damaging	Het
Slc6a2	T	A	8: 92,992,801		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tab2	A	G	10: 7,919,801	S232P	probably benign	Het
Tmem87a	A	G	2: 120,359,542	S544P	probably damaging	Het
Trim52	T	A	14: 106,106,967	C20S	probably damaging	Het
Usp38	A	T	8: 81,014,150	V96E	probably benign	Het
Vmn2r59	T	C	7: 42,058,884	Y33C	probably damaging	Het
Vsig10l	T	G	7: 43,464,137	V171G	probably damaging	Het
Zfp957	T	A	14: 79,212,920	I480F	probably damaging	Het

Other mutations in Tacc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Tacc2	APN	7	130759168	missense	probably damaging	1.00
IGL01396:Tacc2	APN	7	130759189	missense	probably damaging	0.98
IGL01621:Tacc2	APN	7	130729768	missense	probably damaging	0.99
IGL02000:Tacc2	APN	7	130729168	splice site	probably null
IGL02075:Tacc2	APN	7	130728852	missense	probably benign	0.03
IGL02201:Tacc2	APN	7	130626212	missense	possibly damaging	0.84
IGL02205:Tacc2	APN	7	130626682	missense	probably damaging	1.00
IGL02399:Tacc2	APN	7	130623399	missense	probably benign	0.15
IGL02456:Tacc2	APN	7	130626261	missense	probably benign	0.35
IGL02559:Tacc2	APN	7	130759267	missense	probably damaging	1.00
IGL02734:Tacc2	APN	7	130626099	missense	probably damaging	0.98
IGL02800:Tacc2	APN	7	130624079	missense	probably benign	0.40
IGL02938:Tacc2	APN	7	130728941	missense	probably damaging	1.00
IGL03031:Tacc2	APN	7	130623855	missense	possibly damaging	0.94
IGL03278:Tacc2	APN	7	130733568	critical splice donor site	probably null
IGL03283:Tacc2	APN	7	130742266	missense	possibly damaging	0.47
IGL03371:Tacc2	APN	7	130626061	missense	possibly damaging	0.90
aces	UTSW	7	130733528	missense	probably damaging	1.00
Jacks	UTSW	7	130625764	missense	probably damaging	0.98
kings	UTSW	7	130623483	missense	probably damaging	0.96
R0002:Tacc2	UTSW	7	130621785	missense	probably damaging	0.99
R0119:Tacc2	UTSW	7	130621875	missense	probably damaging	0.98
R0244:Tacc2	UTSW	7	130751825	splice site	probably benign
R0619:Tacc2	UTSW	7	130716753	missense	probably damaging	1.00
R0624:Tacc2	UTSW	7	130577509	missense	probably damaging	0.99
R1015:Tacc2	UTSW	7	130624065	missense	probably benign
R1081:Tacc2	UTSW	7	130728574	missense	possibly damaging	0.46
R1086:Tacc2	UTSW	7	130626497	missense	possibly damaging	0.94
R1351:Tacc2	UTSW	7	130663003	intron	probably benign
R1538:Tacc2	UTSW	7	130625419	missense	probably benign	0.03
R1743:Tacc2	UTSW	7	130626598	nonsense	probably null
R1771:Tacc2	UTSW	7	130742240	missense	probably damaging	1.00
R1876:Tacc2	UTSW	7	130623745	missense	probably benign	0.38
R1893:Tacc2	UTSW	7	130625325	missense	probably benign	0.01
R1899:Tacc2	UTSW	7	130624202	missense	possibly damaging	0.81
R2005:Tacc2	UTSW	7	130731550	missense	probably damaging	1.00
R2131:Tacc2	UTSW	7	130621857	missense	possibly damaging	0.90
R2338:Tacc2	UTSW	7	130733569	splice site	probably null
R2407:Tacc2	UTSW	7	130622040	missense	possibly damaging	0.65
R3051:Tacc2	UTSW	7	130625496	missense	possibly damaging	0.81
R3052:Tacc2	UTSW	7	130625496	missense	possibly damaging	0.81
R3053:Tacc2	UTSW	7	130625496	missense	possibly damaging	0.81
R3116:Tacc2	UTSW	7	130759249	missense	probably damaging	1.00
R3412:Tacc2	UTSW	7	130734994	missense	probably benign	0.02
R3683:Tacc2	UTSW	7	130625070	missense	probably benign	0.40
R3685:Tacc2	UTSW	7	130625070	missense	probably benign	0.40
R3872:Tacc2	UTSW	7	130622422	missense	probably benign	0.02
R4063:Tacc2	UTSW	7	130729122	missense	probably damaging	0.97
R4410:Tacc2	UTSW	7	130742211	missense	possibly damaging	0.80
R4434:Tacc2	UTSW	7	130623541	missense	probably damaging	0.96
R4438:Tacc2	UTSW	7	130623541	missense	probably damaging	0.96
R4618:Tacc2	UTSW	7	130626216	missense	probably benign	0.10
R4674:Tacc2	UTSW	7	130624861	missense	possibly damaging	0.75
R4742:Tacc2	UTSW	7	130625967	missense	probably benign	0.00
R4934:Tacc2	UTSW	7	130728588	missense	probably damaging	1.00
R4947:Tacc2	UTSW	7	130625899	missense	probably damaging	0.98
R4964:Tacc2	UTSW	7	130728777	missense	probably damaging	1.00
R4966:Tacc2	UTSW	7	130728777	missense	probably damaging	1.00
R4967:Tacc2	UTSW	7	130623948	missense	probably damaging	0.99
R5052:Tacc2	UTSW	7	130735014	missense	probably damaging	1.00
R5276:Tacc2	UTSW	7	130729317	missense	probably damaging	1.00
R5330:Tacc2	UTSW	7	130733528	missense	probably damaging	1.00
R5331:Tacc2	UTSW	7	130733528	missense	probably damaging	1.00
R5372:Tacc2	UTSW	7	130623260	missense	probably benign	0.09
R5556:Tacc2	UTSW	7	130674606	missense	probably damaging	0.97
R5645:Tacc2	UTSW	7	130624051	missense	possibly damaging	0.80
R5886:Tacc2	UTSW	7	130729120	missense	probably benign	0.18
R5996:Tacc2	UTSW	7	130623483	missense	probably damaging	0.96
R6074:Tacc2	UTSW	7	130625435	missense	possibly damaging	0.92
R6127:Tacc2	UTSW	7	130626115	missense	possibly damaging	0.92
R6156:Tacc2	UTSW	7	130625764	missense	probably damaging	0.98
R6298:Tacc2	UTSW	7	130626525	missense	probably benign	0.26
R6444:Tacc2	UTSW	7	130623412	missense	possibly damaging	0.46
R6533:Tacc2	UTSW	7	130622837	missense	possibly damaging	0.94
R6724:Tacc2	UTSW	7	130728762	missense	probably damaging	1.00
R7111:Tacc2	UTSW	7	130728888	missense	probably benign	0.16
R7150:Tacc2	UTSW	7	130729077	missense	probably benign
R7290:Tacc2	UTSW	7	130729373	missense	probably benign	0.07
R7404:Tacc2	UTSW	7	130623336	missense	probably benign	0.22
R7460:Tacc2	UTSW	7	130624633	missense	probably benign	0.39
R7651:Tacc2	UTSW	7	130623154	missense	probably benign	0.25
R7666:Tacc2	UTSW	7	130716814	start gained	probably benign
R7695:Tacc2	UTSW	7	130728903	missense	probably benign	0.08
R7766:Tacc2	UTSW	7	130743598	missense	probably damaging	1.00
R7793:Tacc2	UTSW	7	130623113	missense	probably benign	0.34
R7861:Tacc2	UTSW	7	130625431	missense	probably benign	0.00
R8204:Tacc2	UTSW	7	130624429	missense	probably damaging	0.97
R8244:Tacc2	UTSW	7	130728676	missense	probably damaging	1.00
R8245:Tacc2	UTSW	7	130729573	missense	probably damaging	1.00
R8283:Tacc2	UTSW	7	130625304	missense	probably benign	0.02
R8348:Tacc2	UTSW	7	130623289	missense	possibly damaging	0.84
R8369:Tacc2	UTSW	7	130622158	missense	probably damaging	0.98
R8381:Tacc2	UTSW	7	130624242	missense	probably benign	0.00
R8804:Tacc2	UTSW	7	130692963	missense	probably benign
R8809:Tacc2	UTSW	7	130674691	missense	possibly damaging	0.94
R8835:Tacc2	UTSW	7	130626528	missense	probably benign	0.00
R8880:Tacc2	UTSW	7	130716834	missense	possibly damaging	0.86
R8918:Tacc2	UTSW	7	130626093	missense	probably benign	0.00
R8936:Tacc2	UTSW	7	130626637	missense	possibly damaging	0.94
R8953:Tacc2	UTSW	7	130625757	missense	probably benign	0.00
R9026:Tacc2	UTSW	7	130623536	missense	probably damaging	1.00
R9193:Tacc2	UTSW	7	130626574	missense	probably benign	0.04
R9221:Tacc2	UTSW	7	130624328	missense	probably damaging	0.98
R9221:Tacc2	UTSW	7	130624479	missense	probably benign	0.00
R9222:Tacc2	UTSW	7	130626255	missense	probably benign	0.00
R9264:Tacc2	UTSW	7	130626803	missense	probably damaging	1.00
R9312:Tacc2	UTSW	7	130622248	missense	probably benign	0.00
R9380:Tacc2	UTSW	7	130625041	missense	possibly damaging	0.86
R9515:Tacc2	UTSW	7	130764311	missense	probably damaging	1.00
R9705:Tacc2	UTSW	7	130759288	missense	probably damaging	1.00
X0010:Tacc2	UTSW	7	130735057	missense	probably damaging	1.00
Z1176:Tacc2	UTSW	7	130623370	missense	probably benign	0.01
Z1176:Tacc2	UTSW	7	130624270	missense	possibly damaging	0.59
Z1176:Tacc2	UTSW	7	130744597	missense	probably damaging	1.00
Z1177:Tacc2	UTSW	7	130624980	missense	probably damaging	1.00
Z1177:Tacc2	UTSW	7	130625774	missense	probably damaging	0.99
Z1177:Tacc2	UTSW	7	130734949	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCCTCCACCTGCTTTGGAAAATGAC -3'
(R):5'- GTGAGACATCAGGACCCTCAAACAG -3'

Sequencing Primer
(F):5'- GCTTTGGAAAATGACACCCTTG -3'
(R):5'- AGCACATTCCTTGGAACTCCTG -3'

Posted On

2013-07-11