Incidental Mutation 'R0632:Tacc2'
ID 59715
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Name transforming, acidic coiled-coil containing protein 2
Synonyms
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0632 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 130179168-130366515 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 130227325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 1356 (K1356*)
Ref Sequence ENSEMBL: ENSMUSP00000149733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207789] [ENSMUST00000207918] [ENSMUST00000208722] [ENSMUST00000215492]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000059145
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084513
AA Change: K1337*
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: K1337*

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207789
Predicted Effect probably null
Transcript: ENSMUST00000207918
AA Change: K1337*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207999
Predicted Effect probably benign
Transcript: ENSMUST00000208722
Predicted Effect probably null
Transcript: ENSMUST00000215492
AA Change: K1356*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130,360,898 (GRCm39) missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130,360,919 (GRCm39) missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130,331,498 (GRCm39) missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130,330,898 (GRCm39) splice site probably null
IGL02075:Tacc2 APN 7 130,330,582 (GRCm39) missense probably benign 0.03
IGL02201:Tacc2 APN 7 130,227,942 (GRCm39) missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130,228,412 (GRCm39) missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130,225,129 (GRCm39) missense probably benign 0.15
IGL02456:Tacc2 APN 7 130,227,991 (GRCm39) missense probably benign 0.35
IGL02559:Tacc2 APN 7 130,360,997 (GRCm39) missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130,227,829 (GRCm39) missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130,225,809 (GRCm39) missense probably benign 0.40
IGL02938:Tacc2 APN 7 130,330,671 (GRCm39) missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130,225,585 (GRCm39) missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130,335,298 (GRCm39) critical splice donor site probably null
IGL03283:Tacc2 APN 7 130,343,996 (GRCm39) missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130,227,791 (GRCm39) missense possibly damaging 0.90
aces UTSW 7 130,335,258 (GRCm39) missense probably damaging 1.00
Jacks UTSW 7 130,227,494 (GRCm39) missense probably damaging 0.98
kings UTSW 7 130,225,213 (GRCm39) missense probably damaging 0.96
R0002:Tacc2 UTSW 7 130,223,515 (GRCm39) missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130,223,605 (GRCm39) missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130,353,555 (GRCm39) splice site probably benign
R0619:Tacc2 UTSW 7 130,318,483 (GRCm39) missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130,179,239 (GRCm39) missense probably damaging 0.99
R1015:Tacc2 UTSW 7 130,225,795 (GRCm39) missense probably benign
R1081:Tacc2 UTSW 7 130,330,304 (GRCm39) missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130,228,227 (GRCm39) missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130,264,733 (GRCm39) intron probably benign
R1538:Tacc2 UTSW 7 130,227,149 (GRCm39) missense probably benign 0.03
R1743:Tacc2 UTSW 7 130,228,328 (GRCm39) nonsense probably null
R1771:Tacc2 UTSW 7 130,343,970 (GRCm39) missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130,225,475 (GRCm39) missense probably benign 0.38
R1893:Tacc2 UTSW 7 130,227,055 (GRCm39) missense probably benign 0.01
R1899:Tacc2 UTSW 7 130,225,932 (GRCm39) missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130,333,280 (GRCm39) missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130,223,587 (GRCm39) missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130,335,299 (GRCm39) splice site probably null
R2407:Tacc2 UTSW 7 130,223,770 (GRCm39) missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130,227,226 (GRCm39) missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130,227,226 (GRCm39) missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130,227,226 (GRCm39) missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130,360,979 (GRCm39) missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130,336,724 (GRCm39) missense probably benign 0.02
R3683:Tacc2 UTSW 7 130,226,800 (GRCm39) missense probably benign 0.40
R3685:Tacc2 UTSW 7 130,226,800 (GRCm39) missense probably benign 0.40
R3872:Tacc2 UTSW 7 130,224,152 (GRCm39) missense probably benign 0.02
R4063:Tacc2 UTSW 7 130,330,852 (GRCm39) missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130,343,941 (GRCm39) missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130,225,271 (GRCm39) missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130,225,271 (GRCm39) missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130,227,946 (GRCm39) missense probably benign 0.10
R4674:Tacc2 UTSW 7 130,226,591 (GRCm39) missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130,227,697 (GRCm39) missense probably benign 0.00
R4934:Tacc2 UTSW 7 130,330,318 (GRCm39) missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130,227,629 (GRCm39) missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130,330,507 (GRCm39) missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130,330,507 (GRCm39) missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130,225,678 (GRCm39) missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130,336,744 (GRCm39) missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130,331,047 (GRCm39) missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130,335,258 (GRCm39) missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130,335,258 (GRCm39) missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130,224,990 (GRCm39) missense probably benign 0.09
R5556:Tacc2 UTSW 7 130,276,336 (GRCm39) missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130,225,781 (GRCm39) missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130,330,850 (GRCm39) missense probably benign 0.18
R5996:Tacc2 UTSW 7 130,225,213 (GRCm39) missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130,227,165 (GRCm39) missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130,227,845 (GRCm39) missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130,227,494 (GRCm39) missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130,228,255 (GRCm39) missense probably benign 0.26
R6444:Tacc2 UTSW 7 130,225,142 (GRCm39) missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130,224,567 (GRCm39) missense possibly damaging 0.94
R6724:Tacc2 UTSW 7 130,330,492 (GRCm39) missense probably damaging 1.00
R7111:Tacc2 UTSW 7 130,330,618 (GRCm39) missense probably benign 0.16
R7150:Tacc2 UTSW 7 130,330,807 (GRCm39) missense probably benign
R7290:Tacc2 UTSW 7 130,331,103 (GRCm39) missense probably benign 0.07
R7404:Tacc2 UTSW 7 130,225,066 (GRCm39) missense probably benign 0.22
R7460:Tacc2 UTSW 7 130,226,363 (GRCm39) missense probably benign 0.39
R7651:Tacc2 UTSW 7 130,224,884 (GRCm39) missense probably benign 0.25
R7666:Tacc2 UTSW 7 130,318,544 (GRCm39) start gained probably benign
R7695:Tacc2 UTSW 7 130,330,633 (GRCm39) missense probably benign 0.08
R7766:Tacc2 UTSW 7 130,345,328 (GRCm39) missense probably damaging 1.00
R7793:Tacc2 UTSW 7 130,224,843 (GRCm39) missense probably benign 0.34
R7861:Tacc2 UTSW 7 130,227,161 (GRCm39) missense probably benign 0.00
R8204:Tacc2 UTSW 7 130,226,159 (GRCm39) missense probably damaging 0.97
R8244:Tacc2 UTSW 7 130,330,406 (GRCm39) missense probably damaging 1.00
R8245:Tacc2 UTSW 7 130,331,303 (GRCm39) missense probably damaging 1.00
R8283:Tacc2 UTSW 7 130,227,034 (GRCm39) missense probably benign 0.02
R8348:Tacc2 UTSW 7 130,225,019 (GRCm39) missense possibly damaging 0.84
R8369:Tacc2 UTSW 7 130,223,888 (GRCm39) missense probably damaging 0.98
R8381:Tacc2 UTSW 7 130,225,972 (GRCm39) missense probably benign 0.00
R8804:Tacc2 UTSW 7 130,294,693 (GRCm39) missense probably benign
R8809:Tacc2 UTSW 7 130,276,421 (GRCm39) missense possibly damaging 0.94
R8835:Tacc2 UTSW 7 130,228,258 (GRCm39) missense probably benign 0.00
R8880:Tacc2 UTSW 7 130,318,564 (GRCm39) missense possibly damaging 0.86
R8918:Tacc2 UTSW 7 130,227,823 (GRCm39) missense probably benign 0.00
R8936:Tacc2 UTSW 7 130,228,367 (GRCm39) missense possibly damaging 0.94
R8953:Tacc2 UTSW 7 130,227,487 (GRCm39) missense probably benign 0.00
R9026:Tacc2 UTSW 7 130,225,266 (GRCm39) missense probably damaging 1.00
R9193:Tacc2 UTSW 7 130,228,304 (GRCm39) missense probably benign 0.04
R9221:Tacc2 UTSW 7 130,226,209 (GRCm39) missense probably benign 0.00
R9221:Tacc2 UTSW 7 130,226,058 (GRCm39) missense probably damaging 0.98
R9222:Tacc2 UTSW 7 130,227,985 (GRCm39) missense probably benign 0.00
R9264:Tacc2 UTSW 7 130,228,533 (GRCm39) missense probably damaging 1.00
R9312:Tacc2 UTSW 7 130,223,978 (GRCm39) missense probably benign 0.00
R9380:Tacc2 UTSW 7 130,226,771 (GRCm39) missense possibly damaging 0.86
R9515:Tacc2 UTSW 7 130,366,041 (GRCm39) missense probably damaging 1.00
R9705:Tacc2 UTSW 7 130,361,018 (GRCm39) missense probably damaging 1.00
X0010:Tacc2 UTSW 7 130,336,787 (GRCm39) missense probably damaging 1.00
Z1176:Tacc2 UTSW 7 130,346,327 (GRCm39) missense probably damaging 1.00
Z1176:Tacc2 UTSW 7 130,226,000 (GRCm39) missense possibly damaging 0.59
Z1176:Tacc2 UTSW 7 130,225,100 (GRCm39) missense probably benign 0.01
Z1177:Tacc2 UTSW 7 130,336,679 (GRCm39) missense possibly damaging 0.96
Z1177:Tacc2 UTSW 7 130,227,504 (GRCm39) missense probably damaging 0.99
Z1177:Tacc2 UTSW 7 130,226,710 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCCACCTGCTTTGGAAAATGAC -3'
(R):5'- GTGAGACATCAGGACCCTCAAACAG -3'

Sequencing Primer
(F):5'- GCTTTGGAAAATGACACCCTTG -3'
(R):5'- AGCACATTCCTTGGAACTCCTG -3'
Posted On 2013-07-11