Incidental Mutation 'R7750:Thop1'
ID597162
Institutional Source Beutler Lab
Gene Symbol Thop1
Ensembl Gene ENSMUSG00000004929
Gene Namethimet oligopeptidase 1
SynonymsEP24.15
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R7750 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location81070035-81082559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 81080191 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 403 (A403S)
Ref Sequence ENSEMBL: ENSMUSP00000005057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005057] [ENSMUST00000117422]
Predicted Effect probably benign
Transcript: ENSMUST00000005057
AA Change: A403S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005057
Gene: ENSMUSG00000004929
AA Change: A403S

DomainStartEndE-ValueType
Pfam:Peptidase_M3 227 677 7e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117422
SMART Domains Protein: ENSMUSP00000112836
Gene: ENSMUSG00000035041

DomainStartEndE-ValueType
low complexity region 179 199 N/A INTRINSIC
BRLZ 237 301 4.36e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kininase that uses zinc as a cofactor. The encoded oligopeptidase cleaves cytosolic peptides, making them unavailable for display on antigen-presenting cells. This protein also cleaves neuropeptides under 20 aa in length and can degrade beta-amyloid precursor protein to amyloidogenic peptides. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,200 D816V possibly damaging Het
Abca16 A T 7: 120,514,705 N933I probably benign Het
Acly A T 11: 100,478,013 probably null Het
Acox1 C T 11: 116,183,580 G105D possibly damaging Het
Ankrd24 A G 10: 81,646,794 E939G possibly damaging Het
Bard1 T A 1: 71,066,942 probably null Het
Brd4 G T 17: 32,213,547 N579K unknown Het
C1qc T C 4: 136,890,281 Y168C probably damaging Het
Casp6 A G 3: 129,912,209 D175G probably damaging Het
Ccdc83 A T 7: 90,223,982 Y388* probably null Het
Clasrp A T 7: 19,584,591 *628R probably null Het
Cox4i1 A G 8: 120,673,310 I111V probably benign Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Epb41l4b C T 4: 57,076,913 probably null Het
Frem2 C A 3: 53,523,682 L2743F possibly damaging Het
Frmd4a A T 2: 4,601,349 H628L probably benign Het
Fyb A G 15: 6,660,703 D809G probably damaging Het
Gm19410 T A 8: 35,807,498 M1491K possibly damaging Het
Gm3604 G A 13: 62,369,996 H183Y possibly damaging Het
H1fnt A G 15: 98,256,684 S195P unknown Het
Lama2 T C 10: 26,990,924 Y2858C probably damaging Het
Methig1 T C 15: 100,353,531 F108L probably benign Het
Mfsd4b5 A G 10: 39,970,255 V443A probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myh9 C T 15: 77,783,410 V608I probably benign Het
Myo1g T C 11: 6,514,849 D475G probably damaging Het
Neb A C 2: 52,280,716 probably null Het
Nlrp1b T A 11: 71,168,839 I769F probably benign Het
Nol8 G T 13: 49,662,266 V617F possibly damaging Het
Olfr715b A T 7: 107,106,533 C109* probably null Het
Pik3r2 A G 8: 70,770,901 F346S probably damaging Het
Pou3f3 T A 1: 42,698,148 F335I probably damaging Het
Ppp1r3e T C 14: 54,876,627 D196G probably damaging Het
Prpf40a T C 2: 53,151,745 T545A probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rprd1a T A 18: 24,508,254 K102* probably null Het
Sim1 A G 10: 50,896,035 T47A possibly damaging Het
Slc45a1 C T 4: 150,644,041 A102T probably damaging Het
Slc6a11 C T 6: 114,230,137 P361S possibly damaging Het
Slc9b2 T C 3: 135,326,237 F286S probably damaging Het
Slco4a1 T C 2: 180,471,237 S421P probably benign Het
Snap91 A C 9: 86,798,709 probably null Het
Sppl2a A G 2: 126,919,705 L293P probably damaging Het
Sval3 T A 6: 41,972,426 I66K possibly damaging Het
Synj2bp T C 12: 81,504,537 I85V probably benign Het
Timd4 T A 11: 46,815,527 M52K probably damaging Het
Tmco5b A G 2: 113,288,264 N111D probably damaging Het
Trip10 G A 17: 57,261,667 V419I possibly damaging Het
Trpv3 T C 11: 73,286,021 Y409H probably damaging Het
Tulp4 A G 17: 6,233,124 T1143A probably damaging Het
Ugt2b5 A T 5: 87,140,249 S20T probably benign Het
Unc5b A G 10: 60,775,044 F406L probably benign Het
Usf3 A G 16: 44,220,521 E1788G probably benign Het
Usp45 A G 4: 21,780,430 D27G probably damaging Het
Vmn2r100 G A 17: 19,522,464 V367I probably benign Het
Vmn2r49 T A 7: 9,976,258 K849I probably damaging Het
Zfp119b A T 17: 55,938,682 H501Q probably damaging Het
Zfp462 C A 4: 55,016,958 H893N probably benign Het
Zkscan4 A G 13: 21,479,355 E88G probably damaging Het
Other mutations in Thop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Thop1 APN 10 81078599 nonsense probably null
IGL00987:Thop1 APN 10 81081695 missense probably damaging 0.99
R0241:Thop1 UTSW 10 81080245 unclassified probably benign
R0842:Thop1 UTSW 10 81075577 missense probably damaging 1.00
R1800:Thop1 UTSW 10 81073209 missense probably damaging 1.00
R1863:Thop1 UTSW 10 81073317 missense probably damaging 0.98
R2507:Thop1 UTSW 10 81070264 start codon destroyed probably null 0.47
R2905:Thop1 UTSW 10 81079591 missense probably damaging 1.00
R2930:Thop1 UTSW 10 81073314 missense probably damaging 0.98
R3898:Thop1 UTSW 10 81080444 missense probably damaging 1.00
R3899:Thop1 UTSW 10 81080444 missense probably damaging 1.00
R4911:Thop1 UTSW 10 81073291 missense probably damaging 1.00
R4924:Thop1 UTSW 10 81080194 missense probably benign 0.11
R4926:Thop1 UTSW 10 81073367 critical splice donor site probably null
R5092:Thop1 UTSW 10 81080578 missense probably damaging 1.00
R5968:Thop1 UTSW 10 81075559 missense probably benign 0.07
R6370:Thop1 UTSW 10 81077983 missense probably benign 0.00
R6733:Thop1 UTSW 10 81081412 missense probably damaging 0.98
R6853:Thop1 UTSW 10 81075661 critical splice donor site probably null
R7355:Thop1 UTSW 10 81075631 missense probably damaging 1.00
R8030:Thop1 UTSW 10 81075616 missense possibly damaging 0.91
R8070:Thop1 UTSW 10 81079486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCCTGGAGCTGAAGGAG -3'
(R):5'- AGAGCCAATGTTCAGTGCCTG -3'

Sequencing Primer
(F):5'- TGCGCTACTACATGAACCAGGTG -3'
(R):5'- AAGCTGCCCTGGACTTC -3'
Posted On2019-11-26